Skip to Content
Merck
All Photos(1)

Key Documents

EHU015721

Sigma-Aldrich

MISSION® esiRNA

targeting human MKL1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGAGCGGAAGAATGTGCTACAGTTGAAACTCCAGCAGCGCCGGACCCGGGAAGAACTGGTGAGCCAAGGGATCATGCCGCCTTTGAAAAGTCCAGCCGCATTTCATGAGCAGAGAAGGAGCTTGGAGCGGGCCAGGACAGAGGACTATCTCAAACGGAAGATTCGTTCCCGGCCGGAGAGATCGGAGCTGGTCAGGATGCACATTTTGGAAGAGACCTCGGCTGAGCCATCCCTCCAGGCCAAGCAGCTGAAGCTGAAGAGAGCCAGACTAGCCGATGACCTCAATGAGAAGATTGCACAGAGGCCTGGCCCCATGGAGCTGGTGGAGAAGAACATCCTTCCTGTTGAGTCCAGCCTGAAGGAAGCCATCATTGTGGGCCAGGTGAACTATCCCAAAGTAGCAGACAGCTCTTCCTTCGATGAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

David Gau et al.
Angiogenesis, 20(4), 663-672 (2017-06-24)
De novo synthesis of cytoskeleton-regulatory proteins triggered by the megakaryoblastic leukemia (MKL)/serum response factor (SRF) transcriptional system in response to pro-angiogenic growth factors lies at the heart of endothelial cell (EC) migration (a critical element of angiogenesis) and neovascularization. This
Xu Shiwen et al.
PloS one, 10(5), e0126015-e0126015 (2015-05-09)
In scleroderma (systemic sclerosis, SSc), persistent activation of myofibroblast leads to severe skin and organ fibrosis resistant to therapy. Increased mechanical stiffness in the involved fibrotic tissues is a hallmark clinical feature and a cause of disabling symptoms. Myocardin Related
Philipp Kircher et al.
Science signaling, 8(402), ra112-ra112 (2015-11-12)
Megakaryoblastic leukemia 1 (MKL1) is a coactivator of serum response factor (SRF) that promotes the expression of genes associated with cell proliferation, motility, adhesion, and differentiation-processes that also involve dynamic cytoskeletal changes in the cell. MKL1 is inactive when bound

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service