Skip to Content
Merck
All Photos(1)

Key Documents

EMU062051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tgm2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTGGTCAGCCTCAGTGCTGGACCAACAGGACAATGTCCTCTCGCTACAGCTCTGCACCCCAGCCAATGCTCCTATTGGCCTGTACCGTCTCAGCCTAGAGGCTTCTACTGGCTACCAGGGCTCCAGCTTTGTGCTGGGCCACTTCATCCTGCTCTACAATGCCTGGTGCCCAGCCGATGATGTGTACCTAGACTCAGAGGAGGAGCGACGGGAATATGTCCTTACGCAACAGGGCTTCATCTACCAAGGCTCTGTCAAGTTCATCAAGAGTGTGCCTTGGAACTTTGGGCAGTTCGAGGATGGAATCCTGGATACCTGCCTGATGCTCTTGGATATGAACCCCAAGTTCCTGAAGAACCGTAGTCGGGACTGCTCACGCCGCAGCAGTCCCATCTATGTGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Deborah T Leicht et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881 (2014-05-16)
Esophageal adenocarcinomas (EAC) are aggressive cancers that are increasing in incidence and associated with a poor prognosis. The identification of highly expressed genes in EAC relative to metaplastic Barrett's esophagus (BE) may provide new targets for novel early cancer detection
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for
Kaiser M Bijli et al.
Shock (Augusta, Ga.), 42(6), 562-569 (2014-07-25)
We addressed the role of transglutaminase 2 (TG2), a calcium-dependent enzyme that catalyzes cross-linking of proteins, in the mechanism of endothelial cell (EC) inflammation and lung polymorphonuclear lymphocyte (PMN) infiltration. Exposure of EC to thrombin, a procoagulant and proinflammatory mediator

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service