Skip to Content
Merck
All Photos(1)

Key Documents

EMU022451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gata2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGGAACGCCAACGGGGACCCTGTGTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACCCGGAATCGGAAGATGTCCAGCAAATCCAAGAAGAGCAAGAAAGGGGCTGAATGTTTCGAGGAGCTCTCCAAGTGCATGCAAGAGAAGTCACCGCCCTTCAGTGCGGCTGCCCTGGCTGGACACATGGCACCTGTGGGACACCTCCCACCTTTTAGTCACTCTGGACACATCCTACCCACGCCCACGCCTATCCACCCTTCCTCCAGTCTCTCTTTTGGCCACCCCCACCCGTCCAGCATGGTGACTGCCATGGGCTAGGCAAGCCTCCCACTGGACAGACATGGACATCAAGGGTGGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gaurang Trivedi et al.
Science translational medicine, 11(511) (2019-09-27)
Adult stem and progenitor cells are uniquely capable of self-renewal, and targeting this process represents a potential therapeutic opportunity. The early erythroid progenitor, burst-forming unit erythroid (BFU-E), has substantial self-renewal potential and serves as a key cell type for the
Song Shen et al.
Molecular pharmaceutics, 11(8), 2612-2622 (2014-02-14)
Synthetic lethal interaction provides a conceptual framework for the development of wiser cancer therapeutics. In this study, we exploited a therapeutic strategy based on the interaction between GATA binding protein 2 (GATA2) downregulation and the KRAS mutation status by delivering
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service