Skip to Content
Merck
All Photos(1)

Key Documents

EHU144891

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGG

Ensembl | human accession no.

ENSG00000125266

NCBI accession no.

NM_004093

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EFNB2(1948) , EFNB2(1948)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Maha Coucha et al.
PloS one, 14(1), e0210523-e0210523 (2019-01-09)
We have previously shown that diabetes causes dysfunctional cerebral neovascularization that increases the risk for cerebrovascular disorders such as stroke and cognitive impairment. Pericytes (PCs) play a pivotal role in the angiogenic process through their interaction with the endothelial cells
Feng Zhu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109972-109972 (2020-02-10)
Ephrin-2 (EFNB2) is expressed at abnormally high levels in some neoplasms, such as squamous cell carcinoma of the head and neck and colorectal cancer. Its overexpression is associated with the malignant progression of tumors. However, the expression of EFNB2 in
Shilpa Bhatia et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(18), 4539-4550 (2018-06-01)
Purpose: The clinical success of targeted therapies such as cetuximab and radiotherapy (RT) is hampered by the low response rates and development of therapeutic resistance. In the current study, we investigated the involvement of EphB4-ephrin-B2 protumorigenic signaling in mediating resistance
Eri Sasabe et al.
PloS one, 12(11), e0188965-e0188965 (2017-12-01)
Oral squamous cell carcinoma (OSCC) is a common malignant tumor of the head and neck and frequently metastasizes to cervical lymph nodes. Aggressive local invasion and metastasis of OSCC are significant factors for poor prognosis. In this study, we investigated
Yan Hu et al.
Neuroscience bulletin, 30(3), 425-432 (2014-01-31)
Postmitotic neurons in the neocortex migrate to appropriate positions and form layered structures of nascent cortex during brain development. The migration of these neurons requires precise control and coordination of a large number of molecules such as axon guidance cues.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service