Skip to Content
Merck
All Photos(1)

Key Documents

EHU104461

Sigma-Aldrich

MISSION® esiRNA

targeting human AZGP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTCCTGCTGTCTCTGCTGCTGCTTCTGGGTCCTGCTGTCCCCCAGGAGAACCAAGATGGTCGTTACTCTCTGACCTATATCTACACTGGGCTGTCCAAGCATGTTGAAGACGTCCCCGCGTTTCAGGCCCTTGGCTCACTCAATGACCTCCAGTTCTTTAGATACAACAGTAAAGACAGGAAGTCTCAGCCCATGGGACTCTGGAGACAGGTGGAAGGAATGGAGGATTGGAAGCAGGACAGCCAACTTCAGAAGGCCAGGGAGGACATCTTTATGGAGACCCTGAAAGACATCGTGGAGTATTACAACGACAGTAACGGGTCTCACGTATTGCAGGGAAGGTTTGGTTGTGAGATCGAGAATAACAGAAGCAGCGGAGCATTCTGGAAATATTACTATGATGGAAAGGACTACATTGAATTCAACAAAGAAATCCCAGCC

Ensembl | human accession no.

ENSG00000160862

NCBI accession no.

NM_001185

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AZGP1(563) , AZGP1(563)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

P M Sanders et al.
British journal of cancer, 90(6), 1274-1278 (2004-03-18)
Lipid-mobilising factor (LMF) is produced by cachexia-inducing tumours and is involved in the degradation of adipose tissue, with increased oxidation of the released fatty acids through an induction of uncoupling protein (UCP) expression. Since UCP-2 is thought to be involved
Yingming Xue et al.
International journal of molecular sciences, 16(1), 691-703 (2015-01-07)
Zinc-α-2-glycoprotein (AZGP1) is a 41-kDa secreted glycoprotein, which has been detected in several malignancies. The diagnostic value of AZGP1 in serum of prostate and breast cancer patients has been reported. Analyzing "The Cancer Genome Atlas" data, we found that in
Xinhua Xiao et al.
Molecular and cellular endocrinology, 439, 155-164 (2016-06-07)
Zinc alpha2 glycoprotein (ZAG) plays an important role in stimulating fat mobilization and lipolysis in adipose tissue, but its role in hepatic lipid metabolism remains unclear. Palmitic acid (PA) was used to stimulate HepG2 cells with ZAG overexpression or ZAG

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service