Skip to Content
Merck
All Photos(1)

Key Documents

EHU024031

Sigma-Aldrich

MISSION® esiRNA

targeting human SP3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTCCTGGTCAAACCCAAGTAGTTGCTAATGTGCCTCTTGGTCTGCCAGGAAATATTACGTTTGTACCAATCAATAGTGTCGATCTAGATTCTTTGGGACTCTCGGGCAGTTCTCAGACAATGACTGCAGGCATTAATGCCGACGGACATTTGATAAACACAGGACAAGCTATGGATAGTTCAGACAATTCAGAAAGGACTGGTGAGCGGGTTTCTCCTGATATTAATGAAACTAATACTGATACAGATTTATTTGTGCCAACATCCTCTTCATCACAGTTGCCTGTTACGATAGATAGTACAGGTATATTACAACAAAACACAAATAGCTTGACTACATCTAGTGGGCAGGTTCATTCTTCAGATCTTCAGGGAAATTATATCCAGTCGCCTGTTTCTGAAGAGACACAGGCACAGAATATTCAGGTTTCTACAGCACAGCCTGTTGTACAGCATCTACAACTTCAAGAGTCTCAGCAGCCAACCAGT

Ensembl | human accession no.

ENSG00000172845

NCBI accession no.

NM_003111

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SP3(6670) , SP3(6670)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan-Yan Xu et al.
Scientific reports, 7(1), 2090-2090 (2017-05-20)
Stimulator of Interferon Gene (STING) is a key mediator of innate immune signaling. STING plays a pivotal role in the pathogenesis of many diseases including infectious diseases, auto-immune diseases and cancer. Many studies have been carried out recently in the
Yinxian Wen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12834-12846 (2020-08-09)
Maternal dexamethasone decreases the body length of the newborn. However, whether dexamethasone inhibits the development of the growth plate of the fetal long bone is still unknown. Here, we found that lengths of fetal femur and growth plate were both
Shawn T Beug et al.
Science signaling, 12(566) (2019-01-31)
The controlled production and downstream signaling of the inflammatory cytokine tumor necrosis factor-α (TNF-α) are important for immunity and its anticancer effects. Although chronic stimulation with TNF-α is detrimental to the health of the host in several autoimmune and inflammatory
Michael A Peplowski et al.
Journal of molecular medicine (Berlin, Germany), 96(10), 1081-1093 (2018-08-10)
Aquaporin (AQP) 3 expression is altered in inflammatory bowel diseases, although the exact mechanisms regulating AQP abundance are unclear. Although interferon gamma (IFNγ) is centrally involved in intestinal inflammation, the effect of this cytokine on AQP3 expression remains unknown. HT-29

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service