Skip to Content
Merck
All Photos(1)

Key Documents

EHU022531

Sigma-Aldrich

MISSION® esiRNA

targeting human ULK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGAACCTCGCCAAGTCTCAGACGCTGCTGGGGAAGGAAATCAAAATCCTGAAGGAACTGAAACATGAAAACATCGTGGCCCTGTACGACTTCCAGGAAATGGCTAATTCTGTCTACCTGGTTATGGAGTACTGCAACGGTGGGGACCTGGCCGACTACCTGCACGCCATGCGCACGCTGAGCGAGGACACCATCAGGCTCTTCCTGCAGCAGATCGCGGGCGCCATGCGGCTTCTGCACAGCAAAGGCATCATCCACCGCGACCTGAAACCGCAGAACATCCTGCTGTCCAACCCCGCCGGCCGCCGCGCCAACCCCAACAGCATCCGCGTCAAGATCGCTGACTTCGGCTTCGCGCGGTACCTCCAGAGCAACATGATGGCGGCCACACTCTGCGGCTCCCCCATGTACATGGCCCCCGAGGTCATCATGTCCCAGCACTACGACGGGAAGGCGGACCTGTGGAGCATCGGCACCATCGTCTACCAGTGCCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shan Zhu et al.
Autophagy, 9(3), 317-327 (2012-12-18)
IFN1@ (interferon, type 1, cluster, also called IFNα) has been extensively studied as a treatment for patients with chronic myeloid leukemia (CML). The mechanism of anticancer activity of IFN1@ is complex and not well understood. Here, we demonstrate that autophagy
Tiejian Nie et al.
Cell death & disease, 7(12), e2563-e2563 (2016-12-30)
Endoplasmic reticulum (ER) stress is involved in many cellular processes. Emerging evidence suggests that ER stress can trigger autophagy; however, the mechanisms by which ER stress regulates autophagy and its role in this condition are not fully understood. HIV Tat-interactive
Min Liu et al.
Toxicology letters, 283, 106-115 (2017-11-13)
Mitochondrial aldehyde dehydrogenase 2 (ALDH2), an important enzyme in the elimination of toxic aldehydes, is involved in cardioprotection against diabetes mellitus. This study was designed to examine the mechanism behind ALDH2-offered protection against high glucose exposure with a focus on
Yalitza Lopez Corcino et al.
Scientific reports, 9(1), 669-669 (2019-01-27)
Little is known about strategies used by pathogens to facilitate CNS invasion. Toxoplasma gondii reaches the CNS by circulating in blood within leukocytes or as extracellular tachyzoites. T. gondii induces EGFR signaling in vitro during invasion of mammalian cells. We
Arup Sarkar et al.
The Journal of infectious diseases, 216(12), 1655-1666 (2017-10-14)
Macrophages are specialized phagocytic cells involved in clearing invading pathogens. Previously we reported that engulfment and cell motility protein 1 (ELMO1) in macrophages mediates bacterial internalization and intestinal inflammation. Here we studied the role of ELMO1 in the fate of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service