Skip to Content
Merck
All Photos(1)

Key Documents

EHU018981

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB11A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAGCAGGGCAAGAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCTTATTGGTTTATGACATTGCTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAGAACTGAGAGATCATGCTGATAGTAACATTGTTATCATGCTTGTGGGCAATAAGAGTGATCTACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGAGCTTTTGCAGAAAAGAATGGTTTGTCATTCATTGAAACTTCGGCCCTAGACTCTACAAATGTAGAAGCTGCTTTTCAGACAATTTTAACAGAGATTTACCGCATTGTTTCTCAGAAGCAAATGTCAGACAGACGCGAAAATGACATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Danyi Zhao et al.
Acta biochimica Polonica, 67(4), 531-538 (2020-12-17)
Esophageal cancer (EC) recently has become a common malignancy of digestive system worldwide. RAB11A is a critical member of the small GTPases superfamily and was reported to affect a variety of cellular functions. However, its potential effects on EC progression
Liane Rauch et al.
Traffic (Copenhagen, Denmark), 15(10), 1083-1098 (2014-07-22)
Bacteria that invade human endothelial cells can be efficiently eliminated in phagolysosomes. We investigated the role of vesicle tethering exocyst complex in maturation and function of endothelial cell phagosomes harbouring staphylococci or latex beads. Exocyst complex proteins (Sec5, -8, -10
Ola Sabet et al.
Nature communications, 6, 8047-8047 (2015-08-22)
Autocatalytic phosphorylation of receptor tyrosine kinases (RTKs) enables diverse, context-dependent responses to extracellular signals but comes at the price of autonomous, ligand-independent activation. Using a conformational biosensor that reports on the kinase activity of the cell guidance ephrin receptor type-A

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service