Skip to Content
Merck
All Photos(1)

Key Documents

EHU010131

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACAGATCAGCACCAAATGCTAACCCAAGGAGCAGGTAATCGCAAGTTCAAATGCACAGAGTGTGGCAAGGCCTTCAAATATAAACACCATCTGAAAGAACACCTGCGAATTCACAGTGGTGAAAAACCTTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCATTCTGGTTCCTACAGTTCGCACATCAGCAGCAAGAAATGTATTGGTTTAATCTCTGTAAATGGCCGAATGAGAAACAATATCAAGACGGGTTCTTCCCCTAATTCTGTTTCTTCTTCTCCTACTAATTCAGCCATTACCCAGTTAAGAAACAAGTTGGAGAATGGAAAACCACTTAGTATGTCTGAACAGACAGGCTTACTTAAAATTAAAACAGAACCACTAGACTTCAATGACTATAAAGTTCTTATGGCTACACACGGGTTTAGTGGCACTAGTCCCTTTATGAATGGTGGGCTTGGAGCCACCAGCCCTTTAGGAGTTCATCCATCTGCTCAGAGTCCAATGCAGCACTTAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Loukia N Lili et al.
Cancer letters, 428, 184-191 (2018-05-08)
Expression levels of the miR-200 family of miRNAs are significantly reduced during the epithelial-to-mesenchymal transition (EMT) and consequent metastasis of ovarian and other cancers. Consistently, ectopic over-expression of miR-200 family miRNAs in mesenchymal-like cells reverses the process by converting treated
Tao Jiang et al.
Oncology reports, 38(1), 151-158 (2017-05-24)
This study was specifically designed to confirm the hypothesis that microRNA-200c (miR-200c) affects the development of cisplatin (DDP) resistance in human gastric cancer cells by targeting zinc finger E-box binding homeobox 2 (ZEB2). A total of 50 gastric cancer tissues and
D-M Geng et al.
European review for medical and pharmacological sciences, 21(8), 1746-1752 (2017-05-10)
To investigate the effect of ZEB2 silencing on cisplatin resistance in gastric cancer. The resulting cell line, SGC7901/DDP, was transfected with ZEB2 siRNA, non-specific siRNA, or vehicle control. The effectiveness of ZEB2 silencing was evaluated by reverse transcriptase-polymerase chain reaction
Steven Goossens et al.
Blood, 129(8), 981-990 (2017-01-11)
Elevated expression of the Zinc finger E-box binding homeobox transcription factor-2 (ZEB2) is correlated with poor prognosis and patient outcome in a variety of human cancer subtypes. Using a conditional gain-of-function mouse model, we recently demonstrated that ZEB2 is an
Sanchari Roy et al.
Clinical science (London, England : 1979), 130(14), 1197-1207 (2016-04-30)
miR-192-5p has gained increasing relevance in various diseases, however, its function in acute liver injury is currently unknown. We analysed miR-192-5p serum levels and hepatic miR-192-5p expression in mice after hepatic ischaemia and reperfusion (I/R) as well as in toxic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service