콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU216481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vcan

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTCATAGCAAGCCCAGAGCAGCTGTTTGCCGCCTATGAGGATGGATTTGAGCAGTGTGATGCAGGATGGCTGTCTGATCAAACTGTCAGATATCCCATACGGGCTCCCCGAGAGGGCTGTTACGGAGACATGATGGGGAAGGAAGGGGTTCGGACCTATGGATTCCGCTCTCCCCAGGAAACCTATGATGTGTATTGTTATGTGGATCATCTGGATGGCGATGTGTTCCACATCACTGCTCCCAGTAAGTTCACCTTCGAGGAGGCCGAAGCAGAGTGTACAAGCAGGGATGCGAGGCTGGCGACTGTTGGAGAACTTCAGGCAGCTTGGAGAAATGGCTTTGACCAATGCGATTACGGCTGGCTGTCGGATGCCAGCGTGCGGCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGAGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACATGCTTCCCTCTCCCTGATAGCAGATTTGATGCCTACTGCTTTAAA

Ensembl | 마우스 수납 번호

ENSMUSG00000021614

NCBI 수납 번호

NM_019389

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... VCAN(13003) , Vcan(13003)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Naoko Arichi et al.
Oncoscience, 2(2), 193-204 (2015-04-11)
In the current study, we investigated a combination of docetaxel and thalidomide (DT therapy) in castration-resistant prostate cancer (CRPC) patients. We identified marker genes that predict the effect of DT therapy. Using an androgen-insensitive PC3 cell line, we established a
Pamela A Havre et al.
BMC cancer, 13, 517-517 (2013-11-05)
CD26/dipeptidyl peptidase IV (DPPIV) is a multifunctional membrane protein with a key role in T-cell biology and also serves as a marker of aggressive cancers, including T-cell malignancies. Versican expression was measured by real-time RT-PCR and Western blots. Gene silencing
Lu-lu Xu et al.
Respiratory physiology & neurobiology, 215, 58-63 (2015-05-23)
COPD lung is characterized by loss of alveolar elastic fibers and an increase in the chondroitin sulfate (CS) matrix proteoglycan versican V1 (V1). V1 is a known inhibitor of elastic fiber deposition and this study investigates the effects of knockdown
Zi Wang et al.
Oncology reports, 33(6), 2981-2991 (2015-04-16)
The systematic application of antiangiogenic therapy remains an issue of concern, mainly due to the hypoxic and inflammatory changes in the tumor microenvironment elicited by antiangiogenic therapy. Versican, a 'bridge' connecting inflammation with tumor progression as well as playing a
Jon M Carthy et al.
Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology, 24(6), 368-374 (2015-09-24)
Versican is a versatile and highly interactive chondroitin sulfate proteoglycan that is found in the extracellular matrix (ECM) of many tissues and is a major component of developing and developed lesions in atherosclerotic vascular disease. In this paper, we present
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.