콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU210841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse E2f3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCGAGAGTGGCCATCAGTACCTCTCAGATGGTCTAAAGACCCCCAAGGGCAAAGGAAGAGCTGCACTACGGAGTCCCGATAGTCCAAAAACTCCAAAATCTCCCTCAGAAAAAACGCGGTATGATACGTCCCTCGGTCTGCTCACCAAGAAGTTCATTCAGCTCCTGAGCCAGTCTCCTGATGGGGTCCTGGATCTGAACAAGGCAGCAGAGGTGCTCAAGGTGCAGAAGAGGAGGATTTACGACATCACCAACGTGCTGGAAGGCATCCACCTCATTAAGAAGAAGTCTAAGAACAACGTCCAGTGGATGGGCTGCAGTCTGTCTGAGGATGGGGGCATGCTGGCCCAGTGTCAAGGCCTGTCCAAAGAAGTGACTGAGCTCAGTCAGGAAGAGAAGAAATTAGATGAGCTGATCCAAAGCTGTACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAAGGTTAGCTTATGTTACA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dianzhong Geng et al.
International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 25(4), 707-713 (2015-02-13)
Previous studies confirmed that high-risk human papillomavirus (HR-HPV) infection is a risk factor of cervical cancer, and the infection was associated with significantly reduced miR-34a expression during carcinogenesis. However, the downstream targets of miR-34a and their roles are still not
Miyoung Lee et al.
Oncotarget, 6(35), 37316-37334 (2015-10-30)
The E2F transcriptional activators E2F1, E2F2 and E2F3a regulate many important cellular processes, including DNA replication, apoptosis and centrosome duplication. Previously, we demonstrated that silencing E2F1 or E2F3 suppresses centrosome amplification (CA) and chromosome instability (CIN) in Her2+ breast cancer
Su'e Chang et al.
Oncotarget, 6(10), 7675-7685 (2015-03-13)
VitaminD3 signaling is involved in inhibiting the development and progression of gastric cancer (GC), while the active vitamin D metabolite 1-alpha,25-dihydroxyvitamin D3 (1,25(OH)2D3)-mediated gene regulatory mechanisms in GC remain unclear. We found that miR-145 is induced by 1,25(OH)2D3 in a

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.