설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCAACTAAACATGGGCAAAGGAGATCCTAAAAAGCCGAGAGGCAAAATGTCCTCATATGCATTCTTTGTGCAAACTTGCCGGGAGGAGCACAAGAAGAAGCACCCGGATGCTTCTGTCAACTTCTCAGAGTTCTCCAAGAAGTGCTCAGAGAGGTGGAAGACCATGTCTGCTAAAGAAAAGGGGAAATTTGAAGATATGGCAAAGGCTGACAAGGCTCGTTATGAAAGAGAAATGAAAACCTACATCCCCCCCAAAGGGGAGACCAAAAAGAAGTTCAAGGACCCCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... HMGB1(100862258) , Hmgb1(15289)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Role of high-mobility group box 1 in methamphetamine-induced activation and migration of astrocytes.
Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process
Yan Chen et al.
International journal of clinical and experimental pathology, 8(6), 6683-6691 (2015-08-12)
Diabetic nephropathy (DN) is one of the most devastating complications of diabetes, leading the cause of end-stage renal disease (ESRD). And investigations into mechanisms underlying renal inflammation may provide new insight into novel therapeutic targets for patients with DN. However
Zhe Liu et al.
Chinese journal of cancer research = Chung-kuo yen cheng yen chiu, 27(3), 267-278 (2015-07-15)
The purpose of this study was to examine the effect of gemcitabine (GEM) on microRNA-218 (miR-218) expression in human pancreatic cancer cells. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to examine the differences in miR-218 expression between the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.