콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU208701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dlc1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGCAAAGAAAACAGAGTTTGGGCAAACCAGACCAGAAAGACCTGAATGAAAACCTAGCGGCGACTCAAGGGCTGGCCCACATGATTGCTGAGTGCAAGAAGCTCTTCCAGGTCCCTGAGGAAATGAGCCGGTGCCGTAACTCCTACACTGAACAAGAGCTGAAGCCCCTTACCCTGGAGGCCTTGGGACACCTGAATAGTGACCAGCCTGCTGACTACAGACACTTCCTCCAGGACTGTGTGGATGGCCTGTTTAAGGAGGTCAAAGAGAAGTTCAAAGGCTGGGTCAGCTACCCCACCTCCGAACAGGCTGAGCTGTCCTATAAGAAGGTCAGCGAAGGACCCCCGTTAAGGCTTTGGAGGTCAACTATCGAAGTCCCCGCTGCACCCGAGGAGATCTTAAAGCGCCTTCTGAAGGAGCAACACCTCTGGGATGTGGACCTGCTGGACTCCAAGGTGATTGAAATCCTGGACAGCCAGACTGAAATCTACCAATACGTCCAAAACAGCA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Mohammad Golam Sabbir et al.
PloS one, 7(7), e40302-e40302 (2012-07-14)
The Deleted in liver cancer one (Dlc1) tumor suppressor gene encodes a RhoGTPase activating protein (RhoGAP). The Dlc1 gene has multiple transcriptional isoforms and we have previously established a mouse strain containing a gene trap (gt) insertion, which specifically reduces
Ho-Suk Mun et al.
Scientific reports, 5, 17697-17697 (2015-12-08)
Understanding the mechanisms of memory formation is fundamental to establishing optimal educational practices and restoring cognitive function in brain disease. Here, we show for the first time in a non-primate species, that spatial learning receives a special bonus from self-directed
Yi-Ping Shih et al.
Biochimica et biophysica acta, 1853(12), 3258-3265 (2015-10-03)
DLC1 is a RhoGAP-containing tumor suppressor and many of DLC1's functions are absolutely dependent on its RhoGAP activity. Through its RhoGAP domain, DLC1 inhibits the activity of RhoA GTPase, which regulates actin cytoskeleton networks and dis/assembly of focal adhesions. Tensin1
Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.