콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU202811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptprc

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TAAATACTATGAAGTGTCCCTACTTGCCTATGTCAATGGGAAGATTCAAAGAAATGGGACTGCTGAGAAGTGCAATTTTCACACAAAAGCAGATCGTCCGGACAAGGTCAATGGAATGAAAACCTCCCGGCCGACAGACAATAGTATAAATGTTACATGTGGTCCTCCTTATGAAACTAATGGCCCTAAAACCTTTTACATTTTGGTAGTCAGAAGTGGAGGTTCTTTTGTTACAAAATACAACAAGACAAACTGTCAGTTTTATGTAGATAATCTCTACTATTCAACTGACTATGAGTTTCTGGTCTCTTTTCACAATGGAGTGTACGAGGGAGATTCAGTTATAAGAAATGAGTCAACAAATTTTAATGCTAAAGCACTGATTATATTCCTGGTGTTTCTGATTATTGTGACATCAATAGCCTTGCTTGTTGTTTTGTATAAAATCTATGATCTGCGCAAGAAAAGATCCAGCAATTTAGATGAACAACAGGAACTCGTTGAAAGGGA

Ensembl | 마우스 수납 번호

ENSMUSG00000026395

NCBI 수납 번호

NM_011210

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... PTPRC(19264) , Ptprc(19264)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Iwona Grabowska et al.
Journal of muscle research and cell motility, 36(6), 395-404 (2015-11-29)
The skeletal muscle injury triggers the inflammatory response which is crucial for damaged muscle fiber degradation and satellite cell activation. Immunodeficient mice are often used as a model to study the myogenic potential of transplanted human stem cells. Therefore, it
Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.
Xu Chang Geng et al.
Molecular medicine reports, 11(5), 3860-3865 (2015-01-13)
Erythropoietin (EPO) is a hematopoietic hormone that protects against renal interstitial fibrosis in animal models; however, the mechanism underlying the anti‑fibrotic activity of EPO has remained elusive. The present study aimed to elucidate this mechanism. Twenty‑four male C57BL6 mice were
Kunitoshi Kobayashi et al.
International immunology, 27(7), 333-344 (2015-02-28)
Dimethyl fumarate (DMF) is a modifier of the nuclear factor (erythroid-derived 2)-2 (Nrf2)-kelch-like ECH-associated protein 1 (Keap1) pathway. DMF treatment in the effector phase significantly suppressed the development of Theiler's murine encephalomyelitis virus-induced demyelinating disease (TMEV-IDD) both clinically and histologically.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.