콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU196671

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hmga2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGGCATTCGTATAAGAAAAGCATTGTGTGTGACTCTGTGTCCACTCAGATGCCACCCCCACCATGATCATAGAAAATCTGCTTAGGACACCAAAGATGAGAACTAGACACTACTCTCCTTTCTTTGTGTATAATCTTGTAGACACTTACTTGATTTTTTTTTCTTTTTTTACTTTTCAATTCTGAATGAGACAAAATGCTGGTGTATCTTTTCATACAGCTAGCAAACCAGAATAGGTTATGCTCGTTTTTTGCTTTGTTTTGTTTTTCAAAAAGGGAAGTAAACGAGAACCGTTGACTCCTCCATTTATGGACTCATACACAGCAGCAGGAGTGATAAGCCCACAAGCTCTCTTTCCCGCCTCGGGAAATCTACACAGCCAAAAGCCACTTAGCCATAAATGACACTTGTCAGCCTTGAAGCATCGGAGATAACTAGCTGAGTAAAATGATCCTGTTTTGGAATTTAATGAAAAGGTTAACAGTACCCAATGAACCCACCCAAGTGATGAC

Ensembl | 마우스 수납 번호

ENSMUSG00000056758

NCBI 수납 번호

NM_010441

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... HMGA2(15364) , Hmga2(15364)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhouying Wu et al.
British journal of haematology, 171(5), 818-829 (2015-09-26)
Acute lymphoblastic leukaemia (ALL) in infants is an intractable cancer in childhood. Although recent intensive chemotherapy progress has considerably improved ALL treatment outcome, disease cure is often accompanied by undesirable long-term side effects, and efficient, less toxic molecular targeting therapies
Silvia Parisi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(3), 1046-1058 (2016-12-07)
Lin28 RNA-binding proteins play important roles in pluripotent stem cells, but the regulation of their expression and the mechanisms underlying their functions are still not definitively understood. Here we address the above-mentioned issues in the first steps of mouse embryonic
Chun-Yu Kao et al.
PeerJ, 4, e1683-e1683 (2016-02-20)
High Mobility Group AT-hook 2 (HMGA2) is a nonhistone chromatin-binding protein which acts as a transcriptional regulating factor involved in gene transcription. In particular, overexpression of HMGA2 has been demonstrated to associate with neoplastic transformation and tumor progression in Colorectal
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
You-You Xia et al.
Biochemical and biophysical research communications, 463(3), 357-363 (2015-05-31)
Epithelial-mesenchymal transition (EMT) is associated with invasion and metastasis of cancer cells. High-mobility group AT-hook 2 (HMGA2) has been found to play a critical role in EMT in a number of malignant tumors. However, whether HMGA2 regulates the EMT in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.