콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU196641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkcc

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TCACTCCACCTTTCAGACTCCGGACCGCCTGTATTTTGTGATGGAGTATGTCACTGGGGGCGATTTAATGTACCACATCCAGCAACTGGGCAAGTTTAAGGAGCCTCATGCAGCATTCTACGCTGCGGAAATCGCCATAGGCCTCTTCTTCCTTCACAACCAGGGCATCATCTACAGGGACCTCAAGTTGGATAATGTGATGCTGGATGCTGAAGGACACATCAAGATCACAGACTTTGGCATGTGTAAAGAGAATGTCTTCCCTGGGTCCACAACCCGCACCTTCTGTGGCACCCCAGACTACATAGCACCTGAGATCATTGCCTATCAGCCCTACGGGAAGTCTGTCGACTGGTGGTCTTTTGGGGTCCTGCTGTATGAGATGTTGGCAGGACAGCCACCCTTTGATGGGGAAGATGAGGAAGAGTTGTTTCAAGCCATCATGGAACAAACTGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAAGGGTTCCTGAC

Ensembl | 마우스 수납 번호

ENSMUSG00000078816

NCBI 수납 번호

NM_011102

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... PRKCC(18752) , Prkcc(18752)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sergio Carracedo et al.
BMC developmental biology, 13, 16-16 (2013-05-04)
Protein kinase C epsilon (PKCϵ) belongs to the novel PKC subfamily, which consists of diacylglycerol dependent- and calcium independent-PKCs. Previous studies have shown that PKCϵ is important in different contexts, such as wound healing or cancer. In this study, we
Sergio Carracedo et al.
BMC developmental biology, 13, 2-2 (2013-01-12)
The members of the protein kinase C (PKC) family consist of serine/threonine kinases classified according to their regulatory domain. Those that belong to the novel PKC subfamily, such as PKCδ, are dependent on diacylglycerol but not Calcium when considering their
Feng Chen et al.
PloS one, 9(7), e99823-e99823 (2014-07-16)
Gram positive (G+) infections make up ∼50% of all acute lung injury cases which are characterized by extensive permeability edema secondary to disruption of endothelial cell (EC) barrier integrity. A primary cause of increased permeability are cholesterol-dependent cytolysins (CDCs) of
Imene Jaadane et al.
Journal of cellular and molecular medicine, 19(7), 1646-1655 (2015-03-18)
Light-induced retinal degeneration is characterized by photoreceptor cell death. Many studies showed that photoreceptor demise is caspase-independent. In our laboratory we showed that leucocyte elastase inhibitor/LEI-derived DNase II (LEI/L-DNase II), a caspase-independent apoptotic pathway, is responsible for photoreceptor death. In
W Miklos et al.
Cancer letters, 361(1), 112-120 (2015-03-10)
Although triapine is promising for treatment of advanced leukemia, it failed against solid tumors due to widely unknown reasons. To address this issue, a new triapine-resistant cell line (SW480/tria) was generated by drug selection and investigated in this study. Notably

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.