설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCTCAAAAGATTCAAAGTCCAAGATGGCAACCCTCAAGGACCAGCTGATTGTGAATCTTCTTAAGGAAGAGCAGGCTCCCCAGAACAAGATTACAGTTGTTGGGGTTGGTGCTGTTGGCATGGCTTGTGCCATCAGTATCTTAATGAAGGACTTGGCGGATGAGCTTGCCCTTGTTGACGTCATGGAAGACAAACTCAAGGGCGAGATGATGGATCTCCAGCATGGCAGCCTCTTCCTTAAAACACCAAAAATTGTCTCCAGCAAAGACTACTGTGTAACTGCGAACTCCAAGCTGGTCATTATCACCGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... LDHA(16828) , Ldha(16828)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Guojun Hua et al.
Oncology reports, 31(6), 2727-2734 (2014-05-03)
Chondrosarcoma is a malignant cartilage-forming cancer composed of cells derived from transformed cells that produce cartilage. Conventional chemotherapy and radiotherapy have very limited efficacy in patients with advanced chondrosarcoma. In the present study, we reported a novel therapeutic approach in
Wenyi Sun et al.
PloS one, 10(5), e0125976-e0125976 (2015-05-15)
Oral squamous cell carcinoma (OSCC) comprises a subset of head and neck squamous cell carcinoma (HNSCC) with poor therapeutic outcomes and high glycolytic dependency. Neoadjuvant chemotherapy regimens of docetaxel, cisplatin and 5-fluorouracil (TPF) are currently accepted as standard regimens for
Balkrishna Chaube et al.
Oncotarget, 6(35), 37281-37299 (2015-10-21)
Melanoma is a largely incurable skin malignancy owing to the underlying molecular and metabolic heterogeneity confounded by the development of resistance. Cancer cells have metabolic flexibility in choosing either oxidative phosphorylation (OXPHOS) or glycolysis for ATP generation depending upon the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.