추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GCAAGTCACCATGGCTCAGCAGGCTGCAGACAAGTACCTCTATGTGGATAAAAACTTCATCAATAACCCGCTGGCCCAAGCTGACTGGGCTGCCAAGAAGTTGGTATGGGTGCCTTCCAGCAAGAATGGCTTTGAACCAGCTAGCCTCAAGGAGGAGGTGGGAGAAGAGGCCATTGTAGAGCTGGTAGAGAATGGGAAGAAGGTGAAGGTGAACAAGGACGACATCCAGAAGATGAACCCACCCAAGTTCTCCAAGGTGGAGGACATGGCAGAGCTCACGTGCCTCAACGAAGCTTCGGTGCTGCACAACCTCAAGGAGCGATACTACTCAGGGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MYH9(17886) , Myh9(17886)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Chii J Chan et al.
Biophysical journal, 108(8), 1856-1869 (2015-04-23)
The cellular cytoskeleton is crucial for many cellular functions such as cell motility and wound healing, as well as other processes that require shape change or force generation. Actin is one cytoskeleton component that regulates cell mechanics. Important properties driving
Bing Zhao et al.
Nature communications, 6, 7166-7166 (2015-05-15)
Lgr5+ stem cells are crucial to gut epithelium homeostasis, and therapies targeting these cells hold promise for treatment of gastrointestinal diseases. Here we report that the non-muscle-myosin-II (NMII) heavy chain Myh9 accumulates at epithelial injury sites in mice distal colon
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.