콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU180081

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mif

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCGCTTTGTACCGTCCTCCGGTCCACGCTCGCAGTCTCTCCGCCACCATGCCTATGTTCATCGTGAACACCAATGTTCCCCGCGCCTCCGTGCCAGAGGGGTTTCTGTCGGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCGCACAGTACATCGCAGTGCACGTGGTCCCGGACCAGCTCATGACTTTTAGCGGCACGAACGATCCCTGCGCCCTCTGCAGCCTGCACAGCATCGGCAAGATCGGTGGTGCCCAGAACCGCAACTACAGTAAGCTGCTGTGTGGCCTGCTGTCCGATCGCCTGCACATCAGCCCGGACCGGGTCTACATCAACTATTACGACATGAACGCTGCCAACGTGGGCTGGAACGGTTCCACCTTCGCTTGAGTCCTGGCCCCACTTACCTGCACCGCTGTTCTTTGAGCCTCGCTCCACGTAGTGTTCTGTGTTTATCCACCGGTAGCGATGCCCACCTTC

Ensembl | 마우스 수납 번호

ENSMUSG00000033307

NCBI 수납 번호

NM_010798

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... MIF(17319) , Mif(17319)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
ZRU
PRU

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jie Zeng et al.
Molecular medicine reports, 13(1), 174-180 (2015-11-10)
Macrophage migration inhibitory factor (MIF) is closely associated with tumorigenesis. The present study aimed to investigate the effects of MIF on the proliferation, migration and colony formation of oral squamous cell carcinoma (OSCC), and to quantify the protein expression levels
Y Liu et al.
Cell death & disease, 5, e1361-e1361 (2014-08-08)
Osteosarcoma is a common primary bone tumor in children and adolescents. The drug resistance of osteosarcoma leads to high lethality. Macrophage migration inhibitory factor (MIF) is an inflammation-related cytokine implicated in the chemoresistance of breast cancer. In this study, we
Eun Ju Jeong et al.
Nanoscale, 7(47), 20095-20104 (2015-11-17)
Although chitosan and its derivatives have been frequently utilized as delivery vehicles for small interfering RNA (siRNA), it is challenging to improve the gene silencing efficiency of chitosan-based nanoparticles. In this study, we hypothesized that controlling the spacer arm length
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the
Bruno Costa-Silva et al.
Nature cell biology, 17(6), 816-826 (2015-05-20)
Pancreatic ductal adenocarcinomas (PDACs) are highly metastatic with poor prognosis, mainly due to delayed detection. We hypothesized that intercellular communication is critical for metastatic progression. Here, we show that PDAC-derived exosomes induce liver pre-metastatic niche formation in naive mice and consequently
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.