콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU175361

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dctn4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCCCTTCATGAATGTAAGACTTCTAGTTCTGTATGAAGTGAGGCCATTTTGATTGTAAGCCATAGAAGTTCAGCAAGTAGCCAGGATGCCAGCCTAACTCTAGACTTGCTGTTGTTCTCAGATACTAACATTGAGTTGCAAACCTTAATTTCTGCGACGTGTTCTGCTGCACTTTTCCTTAAAGTACTCCTAGTATGTGGCCAGCAGACCTTGGAAGAGAACGCTCCTGCTTACAAACCCTGCTTTGGTTTTCATTTTAAGTCTGCGGAGTTTTGTTTTGTATTAAGGAATGTATAGACTGTACTACAGATAGAAAATAGTCTTTGTTTGTTCTACTTAAGAGAAACCGCTTAGGAAGCTATTGAAAGACACTTTGTTCTTTAAAGATCTTAAGATCAAGCCAATTTCATGAAACAATATTCCCAGAGAGTAATATATGTACTAGAGTAAAGAAGAAAATACTGACCTAATACAACGAGAACAATAATGTCTGCCTCTTAGAAGCTGGAG

Ensembl | 마우스 수납 번호

ENSMUSG00000024603

NCBI 수납 번호

NM_026302

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... DCTN4(67665) , Dctn4(67665)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
Young-Ok Son et al.
The Journal of biological chemistry, 290(45), 27090-27100 (2015-09-20)
Arsenic (As(3+)) is a carcinogen with considerable environmental and occupational relevancy. The present study shows that As(3+)-transformed human lung bronchial epithelial BEAS-2B cells (AsT cells) exhibit the property of apoptosis resistance. The level of basal reactive oxygen species (ROS) is
Ashwani Khurana et al.
Oncotarget, 6(34), 36354-36369 (2015-10-27)
A promising new strategy for cancer therapy is to target the autophagic pathway. In the current study, we demonstrate that the antimalarial drug Quinacrine (QC) reduces cell viability and promotes chemotherapy-induced cell death in an autophagy-dependent manner more extensively in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.