설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGAGAGGAAGCGCAAGTCTGTTCGCAGATGCATCGTGGACGCTAATCTCAGTGTTCTCAACTTGGTTGTTGTAAAGAAAAGAGAGAAGGATATTCCTGGACTGACAGATACTACTGTGCCTCGTCGGTTGGGACCTAAAAGGGCTAGTAGAATCCGAAAGCTTTTTAATCTCTCCAAAGAAGATGATGCCTGCCAGTATGCTGTCAGGAAGCCCTTAAACAAAGAAGGTAAGAAGCCCAGGACCAAAGCACCCAAGATTCAGCGTCTTGTTACTCCACACGTCCTGCAACACAAACGCCGACGCATTGCTCTGAAGAAGCAACGCACTAAGAAGAACAAGGAGGAGGCTGCAGAATACGCTAAACTTTTGGCCAAGAGAATGAAGGAAGCCAAAGAAAAGTGCCAGGAACAGACTGCCAAGAGACGTAGGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... Rps6(20104)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Atsuko Tsukimoto et al.
Antiviral research, 117, 1-9 (2015-02-11)
Previous studies have demonstrated that cyclopentenone prostaglandins (cyPGs) inhibit the replication of a wide variety of DNA and RNA viruses in different mammalian cell types. We investigated a new role for prostaglandin A1 (PGA1) in the inhibition of hepatitis C
Lingqin Yuan et al.
Endocrine-related cancer, 22(4), 577-591 (2015-06-06)
Glutamine is one of the main nutrients used by tumor cells for biosynthesis. Therefore, targeted inhibition of glutamine metabolism may have anti-tumorigenic implications. In the present study, we aimed to evaluate the effects of glutamine on ovarian cancer cell growth.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.