콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU094061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atg7

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTTTCTGCTCCTGACCTTCGCGGACCTAAAGAAGTACCACTTCTACTACTGGTTTTGCTGCCCCGCCCTCTGTCTTCCTGAGAGCATCCCTCTAATCCGGGGACCTGTGAGCTTGGATCAAAGGCTTTCACCAAAACAGATCCAGGCCCTGGAGCATGCCTATGATGATCTGTGTCGAGCCGAAGGCGTCACGGCCCTGCCCTACTTCTTATTCAAGTACGATGACGACACTGTTCTGGTCTCCTTGCTCAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACAAAGATAACAGTTGGTGTGTACGATCCCTGTAACCTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTGGCAGCCCACAGATGGAGCGGCAGTTTCCAGTCCGTTGAAGTCC

Ensembl | 마우스 수납 번호

ENSMUSG00000030314

NCBI 수납 번호

NM_028835

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... ATG7(74244) , Atg7(74244)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Bingrong Tang et al.
PloS one, 9(7), e103364-e103364 (2014-07-26)
The two major intracellular protein degradation systems, the ubiquitin-proteasome system (UPS) and autophagy, work collaboratively in many biological processes including development, apoptosis, aging, and countering oxidative injuries. We report here that, in human retinal pigment epithelial cells (RPE), ARPE-19 cells
Hong-Guang Xia et al.
The Journal of cell biology, 210(5), 705-716 (2015-09-02)
Hexokinase II (HK2), a key enzyme involved in glucose metabolism, is regulated by growth factor signaling and is required for initiation and maintenance of tumors. Here we show that metabolic stress triggered by perturbation of receptor tyrosine kinase FLT3 in
Marco B E Schaaf et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 114(3), 406-412 (2015-03-18)
(Pre)clinical studies indicate that autophagy inhibition increases response to anti-cancer therapies. Although promising, due to contradicting reports, it remains unclear if radiation therapy changes autophagy activity and if autophagy inhibition changes the cellular intrinsic radiosensitivity. Discrepancies may result from different
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby
Rong Zheng et al.
Oncotarget, 6(19), 17417-17429 (2015-05-31)
Radiation therapy has an important role in the treatment of breast cancer. Dysfunction p53 and hypoxia are typical biological characteristics of breast cancer that constitute barriers to the efficacy of radiotherapy. Mitophagy plays a protective role in cellular homeostasis under
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.