콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU092131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ube2i

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTGGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCTCACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCATCCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAAGGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAAGCAGCGGCCCTGGGCTCCATGACGAGGAAGGGATTGGCTTGGCAAGAACTTG

Ensembl | 마우스 수납 번호

ENSMUSG00000015120

NCBI 수납 번호

NM_011665

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... UBE2I(22196) , Ube2i(22196)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Marcel Kunadt et al.
Acta neuropathologica, 129(5), 695-713 (2015-03-18)
Extracellular α-Synuclein has been implicated in interneuronal propagation of disease pathology in Parkinson's Disease. How α-Synuclein is released into the extracellular space is still unclear. Here, we show that α-Synuclein is present in extracellular vesicles in the central nervous system.
Tanya M Spektor et al.
PloS one, 6(7), e22785-e22785 (2011-08-11)
PR-Set7/Set8/KMT5a is a chromatin-modifying enzyme that specifically monomethylates lysine 20 of histone H4 (H4K20me1). In this study we attempted to identify PR-Set7-interacting proteins reasoning that these proteins would provide important insights into the role of PR-Set7 in transcriptional regulation. Using
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Faxin Li et al.
Inflammation, 37(4), 1134-1141 (2014-02-18)
Rheumatoid arthritis (RA) is a chronic autoimmune disease with high morbidity and mortality. Fibroblast-like synoviocytes (FLS) in the synovial tissues play critical roles in joint destruction. Recent studies implicate the sumoylation in the regulation of the inflammation and arthritis. Thus

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.