콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU088941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2l1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTGGACAATGGACTGGTTGAGCCCATCTCTATTATAAAAATGTCTCAGAGCAACCGGGAGCTGGTGGTCGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCTGGAGTCAGTTTAGTGATGTCGAAGAGAATAGGACTGAGGCCCCAGAAGAAACTGAAGCAGAGAGGGAGACCCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCGGCCGTGAATGGAGCCACTGGCCACAGCAGCAGTTTGGATGCGCGGGAGGTGATTCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCAGGCGATGAGTTTGAACTGCGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGGGACCGCGTATCAGAGCTTTGAGCAGGTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATCGTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGAGTCGGATTGCA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Laijun Lai et al.
PloS one, 8(12), e82998-e82998 (2013-12-19)
T cell immunodeficiency is a major complication of bone marrow (BM) transplantation (BMT). Therefore, approaches to enhance T cell reconstitution after BMT are required. We have purified a hybrid cytokine, consisting of IL-7 and the β-chain of hepatocyte growth factor
David Chiron et al.
Oncotarget, 6(11), 8750-8759 (2015-03-24)
The aggressive biological behavior of mantle cell lymphoma (MCL) and its short response to current treatment highlight a great need for better rational therapy. Herein, we investigate the ability of ABT-199, the Bcl-2-selective BH3 mimetic, to kill MCL cells. Among
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Yoko Hari et al.
Oncotarget, 6(39), 41902-41915 (2015-10-28)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) induces apoptosis in various types of cancer cells without damaging normal cells. However, in terms of pancreatic cancer, not all cancer cells are sensitive to TRAIL. In this study, we examined a panel
S Marina Casalino-Matsuda et al.
Journal of immunology (Baltimore, Md. : 1950), 194(11), 5388-5396 (2015-04-22)
Hypercapnia, the elevation of CO2 in blood and tissue, commonly develops in patients with advanced lung disease and severe pulmonary infections, and it is associated with high mortality. We previously reported that hypercapnia alters expression of host defense genes, inhibits

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.