콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU082481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CATATGCAGCCAGCAAAGAGTCACATGCCACGTTGGTGTTTCATAATCTCTTGGGTGAAATTGACCAGCAATATAGCCGATTCCTGCAAGAGTCCAATGTCCTCTATCAGCACAACCTTCGAAGAATCAAGCAGTTTCTGCAGAGCAGGTATCTTGAGAAGCCAATGGAAATTGCCCGGATCGTGGCCCGATGCCTGTGGGAAGAGTCTCGCCTCCTCCAGACGGCAGCCACGGCAGCCCAGCAAGGGGGCCAGGCCAACCACCCAACAGCCGCCGTAGTGACAGAGAAGCAGCAGATGTTGGAGCAGCATCTTCAGGATGTCCGGAAGCGAGTGCAGGATCTAGAACAGAAAATGAAGGTGGTGGAGAACCTCCAGGACGACTTTGATTTCAACTACAAAACCCTCAAGAGCCAAGGAGACATGCAGGATCTGAATGGAAACAACCAGTCTGTGACCAGACAGAAGATGCAGCAGCTG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Qiuping Zhao et al.
International immunopharmacology, 25(2), 242-248 (2015-02-15)
High-glucose-induced low-grade inflammation has been regarded as a key event in the onset and progression of endothelial dysfunction in diabetic vascular complications. Ginkgolide A (GA), a major compound from Ginkgo biloba extract, is widely used for the treatment of cardiovascular
Chunli Shao et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4154-4166 (2014-06-08)
Lung cancer stem cells (CSC) with elevated aldehyde dehydrogenase (ALDH) activity are self-renewing, clonogenic, and tumorigenic. The purpose of our study is to elucidate the mechanisms by which lung CSCs are regulated. A genome-wide gene expression analysis was performed to
Ling Qin et al.
American journal of translational research, 7(5), 878-890 (2015-07-16)
MiR-29b has been reported to function as a tumor suppressor in a variety of cancers. However, its role in the regulation of breast cancer is controversial. In this paper, we explored the expression of miR-29b in a cohort of 67
S Timme et al.
Oncogene, 33(25), 3256-3266 (2013-08-06)
Signal transducer and activator of transcription 3 (STAT3) is altered in several epithelial cancers and represents a potential therapeutic target. Here, STAT3 expression, activity and cellular functions were examined in two main histotypes of esophageal carcinomas. In situ, immunohistochemistry for
Anuradha Bandaru et al.
European journal of immunology, 44(7), 2013-2024 (2014-03-20)
We studied the factors that regulate IL-23 receptor expression and IL-17 production in human tuberculosis infection. Mycobacterium tuberculosis (M. tb)-stimulated CD4(+) T cells from tuberculosis patients secreted less IL-17 than did CD4(+) T cells from healthy tuberculin reactors (PPD(+) ).

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.