콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU082041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CATCAATGGCAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGATAACAGACCTGAGTTTCTGCACCAGGTTTGGAATGGGTCTGTTCCAGAGGGATCAAAGCCTGGGACGTATGTGATGACGGTCACTGCCATTGATGCGGATGATCCAAATGCCCTGAATGGAATGCTGCGGTACAGGATCCTGTCCCAGGCGCCCAGCACACCTTCACCCAACATGTTTACAATCAACAATGAGACTGGGGACATCATCACTGTGGCAGCTGGTCTGGATCGAGAGAAAGTGCAACAGTATACGTTAATAATTCAAGCCACAGACATGGAAGGCAATCCCACTTATGGCCTTTCAAACACAGCCACAGCCGTCATCACGGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACTTTCTACGGAGAAGTCCCTGAGAACAGGGTGGACGTCAT

Ensembl | 마우스 수납 번호

ENSMUSG00000024304

NCBI 수납 번호

NM_007664

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... CDH2(12558) , Cdh2(12558)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yu-Huan Tsai et al.
PLoS pathogens, 9(5), e1003381-e1003381 (2013-06-06)
Listeria monocytogenes (Lm) is an invasive foodborne pathogen that leads to severe central nervous system and maternal-fetal infections. Lm ability to actively cross the intestinal barrier is one of its key pathogenic properties. Lm crosses the intestinal epithelium upon the
M-R Lee et al.
Cell death & disease, 5, e1113-e1113 (2014-03-15)
Endoplasmic reticulum (ER) stress is considered one of the pathological mechanisms of idiopathic pulmonary fibrosis (IPF). Therefore, we examined whether an ER stress regulator, Bax inhibitor-1 (BI-1), regulates collagen accumulation, which is both a marker of fibrosis and a pathological
Maorong Jiang et al.
Neurochemical research, 39(11), 2047-2057 (2014-08-15)
Chitosan-based tissue engineered nerve grafts are successfully used for bridging peripheral nerve gaps. The biodegradation products of chitosan are water-dissolvable chitooligosaccharides (COSs), which have been shown to support peripheral nerve regeneration. In this study, we aimed to examine in vitro
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Xuebing Yan et al.
Molecular medicine reports, 12(2), 2999-3006 (2015-05-06)
Recent studies have indicated that the epithelial-mesenchymal transition (EMT) is a key molecular mechanism involved in the development of colorectal cancer (CRC). N-cadherin is a mesenchymal marker of the EMT and has been closely linked to several human malignancies. However

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.