설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACCAACCTGAAGACCCTCCTGTCTGTTGGAGGGTGGAAATTTGGCGAAAAAAGATTTTCCGAGATTGCCTCCAACACTGAGAGACGCACTGCTTTCGTCCGGTCGGTAGCCCCGTTCCTGCGTTCTTATGGCTTTGATGGGCTGGATCTCGCCTGGCTCTACCCTCGCTTAAGAGACAAGCAGTATTTCTCCACCCTGATCAAGGAACTGAATGCGGAATTCACAAAGGAGGTCCAGCCAGGCAGAGAGAAACTCCTGCTCAGCGCAGCTTTGTCAGCAGGAAAGGTGGCCATTGACACTGGCTATGACATCGCCCAGATAGCCCAACACCTGGATTTTATCAATCTCATGACCTACGATTTCCATGGAGTCTGGCGCCAAATCACAGGCCACCACAGCCCCCTCTTCCAAGGCCAGAAGGACACTAGGTTTGACAGATACAGCAATGTGAACTATGCCGTGCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... CHI3L1(12654) , Chi3l1(12654)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Do-Hyun Kim et al.
Nature communications, 9(1), 503-503 (2018-02-07)
Chitinase-3-like-1 (Chi3l1) is known to play a significant role in the pathogenesis of Type 2 inflammation and cancer. However, the function of Chi3l1 in T cell and its clinical implications are largely unknown. Here we show that Chi3l1 expression was
Yu Yeon Jung et al.
Theranostics, 8(3), 749-766 (2018-01-19)
Although the important role of amyloid precursor protein (APP) in vascular diseases associated with Alzheimer's disease (AD) has been demonstrated, the underlying molecular mechanisms and physiological consequences are unclear. We aimed to evaluate vascular inflammation and atherosclerosis in Swedish mutant
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.