콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU079161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tlr8

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTTTCCAGCACTTCCCTCAGGACGATTCCTTCTACCTGGTTTGAAAATCTGTCAAATCTGAAGGAACTCCATCTTGAATTCAACTATTTAGTTCAAGAAATTGCCTCGGGGGCATTTTTAACAAAACTACCCAGTTTACAAATCCTTGATTTGTCCTTCAACTTTCAATATAAGGAATATTTACAATTTATTAATATTTCCTCAAATTTCTCTAAGCTTCGTTCTCTCAAGAAGTTGCACTTAAGAGGCTATGTGTTCCGAGAACTTAAAAAGAAGCATTTCGAGCATCTCCAGAGTCTTCCAAACTTGGCAACCATCAACTTGGGCATTAACTTTATTGAGAAAATTGATTTCAAAGCTTTCCAGAATTTTTCCAAACTCGACGTTATCTATTTATCAGGAAATCGCATAGCATCTGTATTAGATGGTACAGATTATTCCTCTTGGCGAAATCGTCTTC

Ensembl | 마우스 수납 번호

ENSMUSG00000040522

NCBI 수납 번호

NP_573475

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... TLR8(170744) , Tlr8(170744)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Mark A Bernard et al.
PloS one, 9(8), e104039-e104039 (2014-08-05)
Even though combined anti-retroviral therapy (cART) dramatically improves patient survival, they remain at a higher risk of being afflicted with non-infectious complications such as cardiovascular disease (CVD). This increased risk is linked to persistent inflammation and chronic immune activation. In
Noriko Ishii et al.
Journal of immunology (Baltimore, Md. : 1950), 193(10), 5118-5128 (2014-10-10)
Nucleic acid-sensing TLRs are involved in both antimicrobial immune responses and autoimmune inflammation. TLR8 is phylogenetically and structurally related to TLR7 and TLR9, which undergo proteolytic processing in the endolysosomes to generate functional receptors. Recent structural analyses of human TLR8
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.