콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU077471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thbd

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCCAGGCTCTTACTCCTGTATGTGTGAGACAGGCTACCAGTTGGCTGCAGACGGACACCGGTGTGAGGACGTGGATGACTGTAAGCAGGGGCCCAATCCATGTCCCCAGCTCTGTGTTAACACCAAGGGCGGCTTCGAATGCTTCTGCTATGATGGCTATGAGTTGGTGGATGGAGAGTGCGTGGAGCTTCTGGATCCGTGTTTCGGATCTAACTGCGAGTTTCAGTGCCAGCCAGTGAGCCCCACCGACTACCGATGCATCTGCGCTCCAGGCTTCGCACCCAAGCCGGATGAACCGCACAAGTGCGAAATGTTCTGCAATGAAACTTCGTGCCCAGCAGACTGTGACCCTAACTCTCCTACTGTTTGTGAATGCCCTGAAGGCTTCATCCTGGACGAGGGTTCCGTATGCACGGACATTGATGAGTGCAGTCAAGGCGAATGCTTCAC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shahin Assefnia et al.
Oncotarget, 5(6), 1458-1474 (2014-04-01)
Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.
Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
E Klineberg et al.
European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society, 23(11), 2385-2392 (2014-04-18)
Noggin protein levels and spinal fusion rates were compared in a rabbit model after application of siRNA against BMP antagonist noggin in paraspinal muscle. To test whether endogenous BMPs are sufficient to form bone in the absence of their antagonists
Yi Liu et al.
Journal of proteomics, 106, 99-112 (2014-04-29)
Chronic hepatitis B virus (HBV) infection is a major risk factor for hepatocellular carcinoma (HCC), the sixth most common cancer worldwide. To explore potential biomarkers for HCC, iTRAQ coupled with mass spectrometry was used to analyze proteins in plasma from

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.