설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TACACGGTGGTTTGTCTCCAGAGATTAACACTCTAGATGACATCAGAAAATTAGACCGATTCAAAGAACCACCTGCTTATGGGCCCATGTGTGACATCCTATGGTCAGACCCCCTGGAGGACTTTGGAAATGAGAAGACTCAGGAACATTTCACTCACAACACAGTCAGAGGCTGTTCGTACTTCTACAGTTACCCAGCTGTGTGTGACTTCCTGCAGCACAATAATTTGTTGTCCATACTCCGCGCCCACGAAGCCCAGGATGCAGGGTACCGCATGTACAGGAAAAGCCAAACAACAGGCTTCCCGTCTCTAATTACAATCTTCTCGGCACCAAATTACTTAGATGTGTACAATAACAAAGCTGCAGTGTTGAAGTACGAGAACAATGTGATGAACATCAGGCAGTTCAACTGCTCCCCGCATCCGTACTGGCTCCCAAATTTCATG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... PPP3CA(19055) , Ppp3ca(19055)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.