콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU074201

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vdac1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AATGACGGGACAGAGTTTGGTGGCTCCATTTACCAGAAGGTGAACAAGAAGTTGGAGACTGCTGTCAATCTCGCCTGGACTGCAGGAAACAGTAACACTCGCTTCGGAATAGCAGCCAAGTATCAGGTCGACCCTGATGCCTGCTTTTCGGCCAAAGTGAACAACTCTAGCCTGATTGGCTTAGGGTACACTCAGACCCTAAAACCAGGTATCAAACTGACGTTGTCAGCCCTGCTCGATGGCAAGAACGTCAATGCGGGTGGCCACAAGCTTGGCCTAGGACTGGAATTTCAAGCATAAATGAATATTGTACAATCGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTACCTTTTAATGTTGTATGTTGGGGATGCGAGAGTTGATAAATACCACGTTAGACCTCCAGGCTAAGGATGACTCG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Meghraj Singh Baghel et al.
Molecular neurobiology, 56(3), 1707-1718 (2018-06-20)
Our previous report on hippocampal proteome analysis suggested the involvement of voltage-dependent anion channel (Vdac) 1 in scopolamine-induced amnesia. Further silencing of Vdac1 in young mice reduced the recognition memory. Vdac1 is a porin protein present abundantly on outer mitochondrial
A Mitra et al.
Cell death & disease, 4, e582-e582 (2013-04-06)
Cardiac hypertrophy and myocardial infarction (MI) are two major causes of heart failure with different etiologies. However, the molecular mechanisms associated with these two diseases are not yet fully understood. So, this study was designed to decipher the process of
Sergio Gonzalez et al.
The Journal of clinical investigation, 126(3), 1023-1038 (2016-02-16)
Schwann cells produce myelin sheath around peripheral nerve axons. Myelination is critical for rapid propagation of action potentials, as illustrated by the large number of acquired and hereditary peripheral neuropathies, such as diabetic neuropathy or Charcot-Marie-Tooth diseases, that are commonly

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.