설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGATACCCCATTGTGAAACCTGGGCCCAACTGTGGATTTGGGAAAACGGGTATCATCGATTATGGAATCCGGCTCAACAGGAGTGAGCGGTGGGATGCCTATTGCTACAATCCACATGCAAAGGAGTGTGGTGGTGTCTTCACAGATCCGAAGCGAATTTTTAAATCCCCGGGCTTCCCAAATGAGTACGATGACAACCAGGTCTGCTACTGGCACATTCGGCTCAAGTACGGTCAGCGAATTCACCTGAGCTTTTTGGACTTTGACCTTGAACATGATCCAGGCTGCTTGGCTGACTATGTAGAAATCTATGACAGTTATGATGACGTCCACGGCTTTGTAGGAAGATACTGTGGTGATGAACTTCCAGAAGACATCATTAGCACAGGAAATGTCATGACCTTGAAGTTTCTGAGTGATGCATCCGTC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TNFAIP6(21930) , Tnfaip6(21930)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Yi Liu et al.
Journal of neuroinflammation, 11, 135-135 (2014-08-05)
Microglia are the primary immunocompetent cells in brain tissue and microglia-mediated inflammation is associated with the pathogenesis of various neuronal disorders. Recently, many studies have shown that mesenchymal stem cells (MSCs) display a remarkable ability to modulate inflammatory and immune
Yi Liu et al.
Biochemical and biophysical research communications, 450(4), 1409-1415 (2014-07-12)
Dendritic cells (DCs) are potent antigen-presenting cells (APCs) that are characterized by the ability to take up and process antigens and prime T cell responses. Mesenchymal stem cells (MSCs) are multipotent cells that have been shown to have immunomodulatory abilities
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.