설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTCAAGCAAGCTGGAAGACCTGCTAAGGAAGGTTCGAGCCAAGGAGACCAAAAAGCGAGTTCTGTCCAGGTTAAAGTTTAAGCTCGGTGAAGACGTAGTACTCATGGTGGGCATTTATAACTTGGTCCAGAAAGCTAACAAGCCTTTTCCAGTGAGACTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACAAGGACTTTTAATGTAAACACCGGCAGTCTACTCCTGCCTAGTGACACCAAGCGGTCTCTGACTTACGGGACACGTCAGATTGTGCTGGAGAAAGAGGAGACAGAGGAGCTGAAGCGGTTTGATGAGCCAGGTTTGATCCTCATGGGCTTTAAGCCCACGGTGATGCTGAAGAAGCAGCACTACCTGAGGCCCTCTCTGTTCGTGTACCCAGAGGAGTCCCTG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... XRCC6(14375) , Xrcc6(14375)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Bahityar Rahmutulla et al.
Oncotarget, 5(9), 2404-2417 (2014-05-09)
The far-upstream element-binding protein-interacting repressor (FIR) is a c-myc transcriptional suppressor. FIR is alternatively spliced to lack the transcriptional repression domain within exon 2 (FIRΔexon2) in colorectal cancers. FIR and FIRΔexon2 form homo- or heterodimers that complex with SAP155. SAP155
Jin Meng et al.
Molecular medicine reports, 12(1), 581-586 (2015-02-20)
It was previously reported that the histone deacetylase inhibitor (HDACI) trichostatin A (TSA) induced B cell lymphoma 2 (Bcl-2)-associated X protein (Bax)-dependent apoptosis in colorectal cancer (CRC) cells. In addition, Ku70 has been identified as a regulator of apoptosis, the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.