콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU062051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tgm2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATCTTGGTCAGCCTCAGTGCTGGACCAACAGGACAATGTCCTCTCGCTACAGCTCTGCACCCCAGCCAATGCTCCTATTGGCCTGTACCGTCTCAGCCTAGAGGCTTCTACTGGCTACCAGGGCTCCAGCTTTGTGCTGGGCCACTTCATCCTGCTCTACAATGCCTGGTGCCCAGCCGATGATGTGTACCTAGACTCAGAGGAGGAGCGACGGGAATATGTCCTTACGCAACAGGGCTTCATCTACCAAGGCTCTGTCAAGTTCATCAAGAGTGTGCCTTGGAACTTTGGGCAGTTCGAGGATGGAATCCTGGATACCTGCCTGATGCTCTTGGATATGAACCCCAAGTTCCTGAAGAACCGTAGTCGGGACTGCTCACGCCGCAGCAGTCCCATCTATGTGGG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Deborah T Leicht et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881 (2014-05-16)
Esophageal adenocarcinomas (EAC) are aggressive cancers that are increasing in incidence and associated with a poor prognosis. The identification of highly expressed genes in EAC relative to metaplastic Barrett's esophagus (BE) may provide new targets for novel early cancer detection
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for
Kaiser M Bijli et al.
Shock (Augusta, Ga.), 42(6), 562-569 (2014-07-25)
We addressed the role of transglutaminase 2 (TG2), a calcium-dependent enzyme that catalyzes cross-linking of proteins, in the mechanism of endothelial cell (EC) inflammation and lung polymorphonuclear lymphocyte (PMN) infiltration. Exposure of EC to thrombin, a procoagulant and proinflammatory mediator

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.