콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU062011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccr7

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGTCTTCCAGCTGCCCTACAATGGGGTGGTCCTGGCTCAGACGGTGGCCAACTTCAACATCACCAATAGCAGCTGCGAAACCAGCAAGCAGCTCAACATTGCCTATGACGTCACCTACAGCCTGGCCTCCGTCCGCTGCTGCGTCAACCCTTTCTTGTATGCCTTCATCGGCGTCAAGTTCCGCAGCGACCTCTTCAAGCTCTTCAAGGACTTGGGCTGCCTCAGCCAGGAACGGCTCCGGCACTGGTCTTCCTGCCGGCATGTACGGAACGCGTCGGTGAGCATGGAGGCGGAGACCACCACAACCTTCTCCCCGTAGGGGGCTCCCCTGCCCGGACTACAAGGACCTCTCCCAGGAGCCTTAATGTGGTGCACACATGCACAGACTCTCCATCCACCGAATTG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Fei Li et al.
Medical oncology (Northwood, London, England), 31(9), 180-180 (2014-08-22)
Secondary lymphoid tissue chemokine (SLC/CCL21) and its receptor CCR7 have been implicated in lymph node metastasis, whereas the mechanism of which remains unclear. Epithelial-mesenchymal transition (EMT) plays an important role in invasion and migration of cancer cells. We presumed that
Kaori Kubo et al.
Biochemical and biophysical research communications, 463(4), 825-831 (2015-06-24)
Chronic myeloid leukemia is a clonal disease characterized by the presence of the Philadelphia chromosome and its oncogenic product, BCR-ABL, which activates multiple pathways involved in cell survival, growth promotion, and disease progression. We previously reported that in murine hematopoietic
Yang Yue et al.
Oncology reports, 34(6), 3280-3287 (2015-09-10)
In the present study, we aimed to demonstrate whether praline-rich tyrosine kinase-2 (Pyk2) participates in the chemokine receptor 7 (CCR7) downstream signaling network, and to determine the role of this molecule and the related mechanism in the CCR7-mediated regulation of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.