설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
ATGGCTTGCCAGTAGTCACCCTGGTTGGAATCATAGTTGGCGTCTTGTTAGCCATTGGCTTCGTCGGAGGGATCTTCATTGTTGTTATGAAGAAGATTTCTGGAAGGTCTCGCCCTAAAGAGCTAAACAGAACAGGTTGTTCTCCCAACACATCTGAAAATAAGAGAGCTTCCAACTTGCCCTGTTCCCCATCCTCTTCCTGTGGAGGAAGATGACCCATGGCGTGCCCACCCACCCCACCCACAGCCATGGTGACCCCTCCGCTTGGCCAGCAGTACCAAAGGAAAGATACAGGACAAGCCACAGCCCCTCAAAGCATCTGCCTTTGGAAAACTAAATTTTTAACATAAATGTTATGATCGATGATTCAAAAGACAACATGCTTAGAAAATGGAGCAAAGCCAA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... PDPN(14726) , Pdpn(14726)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Frédéric Larrieu-Lahargue et al.
PloS one, 7(6), e39540-e39540 (2012-07-05)
Fibroblast Growth Factor receptor (FGFR) activity plays crucial roles in tumor growth and patient survival. However, FGF (Fibroblast Growth Factor) signaling as a target for cancer therapy has been under-investigated compared to other receptor tyrosine kinases. Here, we studied the
A novel multistep mechanism for initial lymphangiogenesis in mouse embryos based on ultramicroscopy.
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined
Yoshihiko Sawa et al.
PloS one, 9(5), e97165-e97165 (2014-05-20)
The toll-like receptor (TLR) has been suggested as a candidate cause for diabetic nephropathy. Recently, we have reported the TLR4 expression in diabetic mouse glomerular endothelium. The study here investigates the effects of the periodontal pathogen Porphyromonas gingivalis lipopolysaccharide (LPS)
Yan Song et al.
Cellular and molecular neurobiology, 34(6), 839-849 (2014-05-14)
Podoplanin (PDPN) is a mucin-type transmembrane sialoglycoprotein expressed in multiple tissues in adult animals, including the brain, lungs, kidney, and lymphoid organs. Studies of this molecule have demonstrated its great importance in tumor metastasis, platelet aggregation, and lymphatic vessel formation.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.