설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CCACCCTCTGGACTGCTAAGTTAGACCGCTTCAAGGGCTCAAAGCACCACACCAGCCTGATCACCTGTCACCGTGCTGGGCCTGCAGGGCCAGATTCCAGCCCCCTTGAACTGTCCGAGTTCCTGTGGGTGGACTTTGCAGTGGAGAACAGCACTGGTGGGGGTGTGGCAGTCACTCGCCCTGTCACGTGGCAGCTGGAGTACCCAGGTCAGGCCCCCGAAGCAGAGAAGGACAAAATGGTGTGGGAGATCCTGGTGTCTGAGCGGGACATCAGAGCCCTCATCCCTCTGGCCAAGGCTGAGGAGCTGGTGAACACGGCTCCATTGACTGGAGTGCCCCAGCGTATTCCGGTGCGGCTCGTCACTGTGGACAGTGGGGGAGCCTTGGAGGAGGTGACAGAGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TMEM132A(98170) , Tmem132a(98170)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Deng He et al.
International journal of molecular sciences, 16(7), 16313-16329 (2015-07-21)
The molecular events leading to nephrolithiasis are extremely complex. Previous studies demonstrated that calcium and transforming growth factor-β1 (TGF-β1) may participate in the pathogenesis of stone formation, but the explicit mechanism has not been defined. Using a self-created genetic hypercalciuric
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.