콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU057051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp7

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACCCTAAGGACCCTGCAAATTATATTCTCCATGCAGTCTTGGTTCACAGTGGAGATAATCATGGTGGACATTACGTGGTTTACCTAAACCCCAAAGGGGATGGCAAATGGTGTAAGTTCGATGATGACGTGGTATCCAGGTGTACTAAAGAAGAAGCCATTGAGCACAATTATGGGGGTCATGATGATGATCTGTCTGTTCGACACTGCACAAATGCCTATATGTTAGTGTACATCAGGGAATCAAAGCTAAGTGAAGTGTTACAAGCTGTCACCGACCATGATATTCCTCAGCAGTTGGTGGAACGATTGCAAGAAGAGAAAAGGATCGAGGCTCAGAAGCGGAAGGAGCGGCAGGAAGCCCATCTCTACATGCAAGTGCAGATAGTTGCAGAGGACCAGTTTTGTGGCCACCAAGGAAATGACATGTACGACGAGGAGAAAGTGAGGTACACTGTGTTCAAGGTTCTGAAGAACTCCTCCCTGGCCGAGTTTGTTCAGAGCCTCTCCCAG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Seemana Bhattacharya et al.
The FEBS journal, 281(13), 3061-3078 (2014-05-16)
Tumor suppressor retinoblastoma-associated protein (Rb) is an important cell cycle regulator, arresting cells in early G1. It is commonly inactivated in cancers and its level is maintained during the cell cycle. Rb is regulated by various post-translational modifications such as
Serena Giovinazzi et al.
Oncotarget, 5(11), 3728-3742 (2014-07-09)
USP7 (Ubiquitin Specific processing Protease-7) is a deubiquitinase which, over the past decade emerged as a critical regulator of cellular processes. Deregulation of USP7 activity has been linked to cancer, making USP7 inhibition an appealing anti-cancer strategy. The identification of
Key-Hwan Lim et al.
Scientific reports, 5, 12793-12793 (2015-08-05)
HAUSP (herpes virus-associated ubiquitin specific protease, known as ubiquitin specific protease 7), one of DUBs, regulates the dynamics of the p53 and Mdm2 network in response to DNA damage by deubiquitinating both p53 and its E3 ubiquitin ligase, Mdm2. Its

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.