설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AACCTGTTGACATCCCGAAGCAATGCTCAGCGCCAGGAAATTGCTCAGGAGTTTAAGACTCTGTTTGGCAGGGACCTTGTGGATGACCTGAAGTCTGAACTGACTGGAAAGTTTGAGAAGTTAATTGTGGCTATGATGAAGCCCTCACGACTCTACGATGCCTACGAGCTGAAGCATGCTCTTAAGGGAGCTGGTACAGACGAGAAAGTATTGACCGAGATTATTGCTTCAAGGACACCTGAAGAACTCAGTGCCATAAAACAAGTTTATGAAGAAGAATATGGTTCCAACCTGGAAGATGATGTGGTGGGGGATACTTCAGGGTACTACCAGAGGATGTTGGTGGTCCTCCTTCAGGCGAATAGAGACCCTGATACTGCAATTGATGATGCTCAAGTTGAACTGGATGCTCAGGCATTGTTCCAGGCTGGAGAGCTGAAGTGGGGGACAGATGAAGAAAAATTCATCACCATCTTTGGGACA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... ANXA5(11747) , Anxa5(11747)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Nahee Park et al.
Journal of toxicology and environmental health. Part A, 77(22-24), 1467-1476 (2014-10-25)
Auranofin is a lipophilic gold compound with anti-inflammatory and immunosuppressive properties. This compound also exerts antiproliferative effects in several human cancer cell lines. Although auranofin induces apoptosis in human cancer cells, the underlying mechanisms remain unclear. This study investigated auranofin-mediated
Jingjing Wang et al.
Oncology reports, 32(6), 2557-2563 (2014-10-18)
Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin's lymphoma worldwide. Although patient outcomes have significantly improved to a greater than 40% cure rate by the combinatorial cyclophosphamide, doxorubicin, vincristine and prednisone (CHOP) chemotherapy, which is widely
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.