콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU054161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Anxa3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTGATGCGAACGAACTGAAGAAATCCATGAAGGGAACTGGCACAGATGAAGATGCCCTGATTGAAATCCTAACAACCAGGTCAAGCAGGCAGATGAAGGAAATCTCGCAGGCCTATTATACAGTGTATAAGAAGAGCCTCGGGGATGACATTAGCTCTGAGACGTCTGGAGACTTCCGGAAAGCTCTGCTGACTCTGGCAGATGGTAGAAGAGATGAAAGCCTCAAAGTGGATGAACATCTGGCCAAAAAGGATGCTCAGATCCTCTATAATGCTGGTGAGAACAAATGGGGCACAGACGAAGACAAATTCACCGAGGTCTTGTGTCTACGGAGCTTCCCGCAGCTGAAACTAACATTTGATGAGTACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATTAAAGGAGAATTATCTGGACATTTTGAAGACCTGCTGCTGGCCATAGTTCATTGTGCGAGGAACACTC

Ensembl | 마우스 수납 번호

ENSMUSG00000029484

NCBI 수납 번호

NM_013470

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... ANXA3(11745) , Anxa3(11745)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

S Y Yu et al.
Neoplasma, 61(3), 257-264 (2014-05-16)
Annexin A3 participates in various biological processes, including tumorigenesis, drug resistance, and metastasis. The aim of this study was to investigate the expression of Annexin A3 in gastric cancer and its relationship with cell differentiation, migration, and invasion of gastric
Qiu-Zhong Pan et al.
Molecular carcinogenesis, 54(8), 598-607 (2014-01-01)
Annexin A3 (ANXA3) has been found to play important roles in cancer progression, metastasis, and drug resistance; however, its role in hepatocellular carcinoma (HCC) remains unknown. In this study, we investigated the expression level, clinical significance and biologic function of
Stryder M Meadows et al.
PloS one, 10(7), e0132580-e0132580 (2015-07-17)
Annexins are a large family of calcium binding proteins that associate with cell membrane phospholipids and are involved in various cellular processes including endocytosis, exocytosis and membrane-cytoskeletal organization. Despite studies on numerous Annexin proteins, the function of Annexin A3 (Anxa3)
Min Jung Lee et al.
Metabolism: clinical and experimental, 64(9), 1134-1145 (2015-06-09)
Autophagy has emerged as a potentially important factor in the pathogenesis of atherosclerosis. Dehydroepiandrosterone (DHEA) is an adrenal steroid of great recent interest due to its anti-aging and anti-atherogenic effects; however, little is known about its role in autophagy and

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.