설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTTTCGGCTTCGTCACTTTCATGGACCAGGCGGGGGTGGATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCCAAGGTGGCCTTTCCTCGAAGAGCACAGCCTAAGATGGTCACTCGGACGAAGAAGATCTTCGTGGGGGGGCTGTCTGTGAACACCACGGTGGAAGATGTGAAACACTATTTCGAGCAGTTCGGAAAGGTGGATGATGCCATGCTGATGTTCGACAAAACCACCAACAGGCACAGAGGGTTTGGATTTGTCACGTTTGAGAGCGAGGACATCGTAGAGAAAGTTTGTGAGATCCACTTCCATGAAATCAACAACAAAATGGTGGAATGCAAGAAAGCCCAGCCAAAGGAGGTGATGTCCCCGACAGGCTCAGCCCGGGGCAGGTCTCGGGTCATGCCCTACGGAATGGATGCCTTCATGCTGGGTAT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... MSI1(17690) , Msi1(17690)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Mitzli X Velasco et al.
RNA (New York, N.Y.), 25(7), 768-782 (2019-04-21)
RNA-binding proteins (RBPs) and miRNAs are critical gene expression regulators that interact with one another in cooperative and antagonistic fashions. We identified Musashi1 (Msi1) and miR-137 as regulators of a molecular switch between self-renewal and differentiation. Msi1 and miR-137 have
In-Sun Hong et al.
PloS one, 8(2), e56496-e56496 (2013-02-19)
Human umbilical cord blood (UCB)-derived mesenchymal stem cells (MSCs) are essential tools for regenerative medicine due to their capacity for self-renewal and multi-lineage differentiation. As MSCs are found in very small numbers in various tissues, in vitro cell expansion is
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.