콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU049451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cltc

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCAGAGCTGGTGTTTCTGTATGACAAGTACGAAGAGTATGACAATGCCATCATTACCATGATGAATCACCCCACCGATGCATGGAAGGAAGGGCAGTTCAAAGACATCATCACCAAGGTGGCTAATGTGGAACTGTACTACAAAGCAATCCAGTTCTACTTAGAATTCAAGCCTTTGTTGTTAAATGACTTGCTCATGGTGCTGTCTCCACGGTTGGATCACACTCGTGCAGTCAATTATTTCAGCAAGGTAAAACAGCTACCACTGGTGAAACCATATTTACGCTCAGTGCAGAACCACAACAACAAATCTGTGAATGAATCACTGAACAACCTCTTTATTACTGAAGAAGATTACCAGGCTCTGCGAACATCAATAGATGCTTATGACAACTTTGACAACATCTCACTTGCTCAGCGTTTG

Ensembl | 마우스 수납 번호

ENSMUSG00000047126

NCBI 수납 번호

NM_001003908

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... CLTC(67300) , Cltc(67300)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dipannita Dutta et al.
Traffic (Copenhagen, Denmark), 16(9), 994-1009 (2015-05-20)
Clathrin-mediated endocytosis (CME) and clathrin-independent endocytosis (CIE) co-exist in most cells but little is known about their communication and coordination. Here we show that when CME was inhibited, endocytosis by CIE continued but endosomal trafficking of CIE cargo proteins was
Annalisa Natalicchio et al.
Diabetologia, 58(6), 1260-1271 (2015-03-27)
The role of the redox adaptor protein p66(Shc) as a potential mediator of saturated fatty acid (FA)-induced beta cell death was investigated. The effects of the FA palmitate on p66(Shc) expression were evaluated in human and murine islets and in
Odette Allonby et al.
Cellular signalling, 26(12), 2645-2657 (2014-08-26)
Ligand-induced internalisation and subsequent downregulation of receptor tyrosine kinases (RTKs) serve to determine biological outputs of their signalling. Intrinsically kinase-deficient RTKs control a variety of biological responses, however, the mechanism of their downregulation is not well understood and its analysis
Xiaofei Yan et al.
Molecular and cellular biochemistry, 398(1-2), 95-104 (2014-09-14)
Excessive reactive oxygen species (ROS) generation has been implicated as one of main agents in ouabain-induced anticancer effect. Unfortunately, the signaling pathways under it are not very clarified. In the present study, we investigated the molecular mechanism involved in ouabain-induced
Cyril Basquin et al.
The EMBO journal, 34(16), 2147-2161 (2015-07-01)
Endocytosis controls many functions including nutrient uptake, cell division, migration and signal transduction. A clathrin- and caveolin-independent endocytosis pathway is used by important physiological cargos, including interleukin-2 receptors (IL-2R). However, this process lacks morphological and dynamic data. Our electron microscopy

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.