콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU048461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rictor

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CAGAAAGCAATCGCAACTCACCACAAGCGGGATCAGTATCTTCGAGTTCAGAAAGATATATTTGTTCTTAAGGATACAGAGGAAGCTCTTTTAATAAACCTTAGAGACAGCCAAGTCCTTCAGCATAAAGAGAATCTTGACTGGGATTGGAATCTGATTGGGACCATCCTTAAGTGGCCAAATGTAAATCTAAGAAACTATAAAGATGAGCAGTTGCACAGGTTTGTGCGCAGACTTCTTTACTTTTACAAGCCCAGCAGCAAACTGTACGCTAGTCTGGATCTGGACTTGGCCAAGTCCAAGCAGCTCACAGTTGTCGGTTGTCAGTTTACAGAATTTCTGCTCGAGTCTGAAGAGGATGGGCAAGGATACTTAGAAGATCTCGTGAAAGATATTGTTCAGTGGCTCAATGCTTCA

Ensembl | 마우스 수납 번호

ENSMUSG00000050310

NCBI 수납 번호

NM_030168

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... RICTOR(78757) , 4921505C17Rik(78757)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Haiying Cheng et al.
Cancer discovery, 5(12), 1262-1270 (2015-09-16)
We identified amplification of RICTOR, a key component of the mTOR complex 2 (mTORC2), as the sole actionable genomic alteration in an 18-year-old never-smoker with lung adenocarcinoma. Amplification of RICTOR occurs in 13% of lung cancers (1,016 cases) in The
Maikel A Farhan et al.
PloS one, 10(8), e0135245-e0135245 (2015-08-22)
Tumor neovascularization is targeted by inhibition of vascular endothelial growth factor (VEGF) or the receptor to prevent tumor growth, but drug resistance to angiogenesis inhibition limits clinical efficacy. Inhibition of the phosphoinositide 3 kinase pathway intermediate, mammalian target of rapamycin
Chi-Hao Chang et al.
Oncotarget, 6(3), 1478-1489 (2015-01-19)
Urothelial carcinoma is the most common type of malignancy in long-term dialysis patients and kidney transplant recipients in Taiwan. mTORCs (mammalian target of rapamycin complexes) and EGF are important in urothelial carcinoma. To identify the regulation of mTORCs upon EGF
Suman Mukhopadhyay et al.
Cell cycle (Georgetown, Tex.), 14(20), 3331-3339 (2015-09-01)
mTOR - the mammalian/mechanistic target of rapamycin - has been implicated as a key signaling node for promoting survival of cancer cells. However, clinical trials that have targeted mTOR with rapamycin or rapamycin analogs have had minimal impact. In spite
Wenteh Chang et al.
PloS one, 9(8), e106155-e106155 (2014-08-28)
A characteristic of dysregulated wound healing in IPF is fibroblastic-mediated damage to lung epithelial cells within fibroblastic foci. In these foci, TGF-β and other growth factors activate fibroblasts that secrete growth factors and matrix regulatory proteins, which activate a fibrotic
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.