설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGCGCTAGGAGAGAAGCAGCCACGCCCGCAACGCGAGCTGAGCAACGCCGAAGACAATGGCAGGCTCGGCGTTGGCAGTTCGGGCTCGGTTCGGTGTCTGGGGTATGAAGGTCCTGCAAACCCGAGGCTTCGTCTCGGACTCGTCGGATAGCATGGATACGGGCGCTGGCTCCATCCGAGAAGCTGGTGGAGCCTTCGGAAAACGAGAAAAGGCTGAAGAGGATCGGTACTTCCGAGAGAAGACTAAAGAACAGCTGGCTGCCCTGAGGAAACACCATGAAGATGAGATTGACCACCATTCGAAGGAGATAGAGCGTCTGCAGAAGCAAATTGAACGCCATAAGAAGAAGATCCAACAACTAAAGAATAATCATTGAATGCGCGCAGTCGGTCCCTCACAGAGTG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... ATPIF1(11983) , Atpif1(11983)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition
Fabrice Ivanes et al.
British journal of pharmacology, 171(18), 4193-4206 (2014-03-20)
Ischaemia compromises mitochondrial respiration. Consequently, the mitochondrial F1 Fo-ATPsynthase reverses and acts as a proton-pumping ATPase, so maintaining the mitochondrial membrane potential (ΔΨm ), while accelerating ATP depletion and cell death. Here we have looked for a molecule that can
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.