설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTTCCCTGACGGTAAAGTGCCCAAATAAAGGCTGTTTGCAAAAGATGGAACTGAGACATCTCGAGGATCATCAAGTACATTGTGAATTTGCTCTAGTGAATTGTCCCCAGTGCCAACGTCCTTTCCAGAAGTGCCAGGTTAATACACACATTATTGAGGATTGTCCCAGGAGGCAGGTTTCTTGTGTAAACTGTGCTGTGTCCATGGCATATGAAGAGAAAGAGATCCATGATCAAAGCTGTCCTCTGGCAAATATCATCTGTGAATACTGTGGTACAATCCTCATCAGAGAACAGATGCCTAATCATTATGATCTGGACTGCCCAACAGCTCCAATCCCTTGCACATTCAGTGTTTTTGGCTGTCATGAAAAGATGCAGAGGAATCACTTGGCACGACACTTG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TRAF6(22034) , Traf6(22034)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Melinda E Varney et al.
The Journal of experimental medicine, 212(11), 1967-1985 (2015-10-16)
TRAF-interacting protein with forkhead-associated domain B (TIFAB) is a haploinsufficient gene in del(5q) myelodysplastic syndrome (MDS). Deletion of Tifab results in progressive bone marrow (BM) and blood defects, including skewed hematopoietic stem/progenitor cell (HSPC) proportions and altered myeloid differentiation. A
Frank Secreto et al.
Leukemia & lymphoma, 55(8), 1884-1892 (2013-11-12)
B-cell activating factor-receptor (BAFF-R) is the primary BAFF receptor that is responsible for promoting B-cell development and survival. Malignant B-cells exploit the BAFF/BAFF-R system, and high serum BAFF levels or genetic alterations in BAFF receptors have been found in B-cell
Domenico Somma et al.
Journal of immunology (Baltimore, Md. : 1950), 194(7), 3286-3294 (2015-02-25)
IL-17 is a proinflammatory cytokine that promotes the expression of different cytokines and chemokines via the induction of gene transcription and the posttranscriptional stabilization of mRNAs. In this study, we show that IL-17 increases the half-life of the Zc3h12a mRNA
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.