콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU046421

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Traf6

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTTCCCTGACGGTAAAGTGCCCAAATAAAGGCTGTTTGCAAAAGATGGAACTGAGACATCTCGAGGATCATCAAGTACATTGTGAATTTGCTCTAGTGAATTGTCCCCAGTGCCAACGTCCTTTCCAGAAGTGCCAGGTTAATACACACATTATTGAGGATTGTCCCAGGAGGCAGGTTTCTTGTGTAAACTGTGCTGTGTCCATGGCATATGAAGAGAAAGAGATCCATGATCAAAGCTGTCCTCTGGCAAATATCATCTGTGAATACTGTGGTACAATCCTCATCAGAGAACAGATGCCTAATCATTATGATCTGGACTGCCCAACAGCTCCAATCCCTTGCACATTCAGTGTTTTTGGCTGTCATGAAAAGATGCAGAGGAATCACTTGGCACGACACTTG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Melinda E Varney et al.
The Journal of experimental medicine, 212(11), 1967-1985 (2015-10-16)
TRAF-interacting protein with forkhead-associated domain B (TIFAB) is a haploinsufficient gene in del(5q) myelodysplastic syndrome (MDS). Deletion of Tifab results in progressive bone marrow (BM) and blood defects, including skewed hematopoietic stem/progenitor cell (HSPC) proportions and altered myeloid differentiation. A
Frank Secreto et al.
Leukemia & lymphoma, 55(8), 1884-1892 (2013-11-12)
B-cell activating factor-receptor (BAFF-R) is the primary BAFF receptor that is responsible for promoting B-cell development and survival. Malignant B-cells exploit the BAFF/BAFF-R system, and high serum BAFF levels or genetic alterations in BAFF receptors have been found in B-cell
Domenico Somma et al.
Journal of immunology (Baltimore, Md. : 1950), 194(7), 3286-3294 (2015-02-25)
IL-17 is a proinflammatory cytokine that promotes the expression of different cytokines and chemokines via the induction of gene transcription and the posttranscriptional stabilization of mRNAs. In this study, we show that IL-17 increases the half-life of the Zc3h12a mRNA

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.