콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU045141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTTGGTGTGGGTCAGGAAATCACATCTTATACCGCTCGAGAGCCGGACACGTTCATGGATCAGAAGATCACGTATCGGATTTGGAGGGACACTGCCAACTGGCTGGAGATTAACCCAGAGACTGGTGCCATTTTCACGCGCGCTGAGATGGACAGAGAAGACGCTGAGCATGTGAAGAACAGCACATATGTAGCTCTCATCATCGCCACAGATGATGGTTCACCCATTGCCACTGGCACGGGCACTCTTCTCCTGGTCCTGTTAGACGTCAATGACAACGCTCCCATCCCAGAACCTCGAAACATGCAGTTCTGCCAGAGGAACCCACAGCCTCATATCATCACCATCTTGGATCCAGACCTTCCCCCCAACACGTCCCCCTTTACTGCTGAGCTAACCCATGGGGCCAGCGTCAACTGGACCATTGAGTATAATGACGCAGCTCAAGAATCTCTCATTTTGCAACCAAGAAAGGACTTAGAGATTGGCGAATACAAAATCCATCTCAAGCTCGCGGATAACCAGAACAAAGACCAGGTGACCACGTTGGACGTCCATGTGTGTGACTGTGAAGGGACGGTCAAC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Chunyan Zhao et al.
Cancer research, 74(14), 3983-3994 (2014-05-17)
Triple-negative breast cancer (TNBC) is an aggressive clinical subtype accounting for up to 20% of all breast cancers, but its malignant determinants remain largely undefined. Here, we show that in TNBC the overexpression of Fra-1, a component of the transcription

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.