콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU037431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Syp

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CAGTGGGTCTTTGCCATCTTCGCCTTTGCTACGTGCGGCAGCTACACCGGAGAGCTTCGGCTGAGCGTGGAGTGTGCCAACAAGACGGAGAGTGCCCTCAACATCGAAGTCGAATTTGAGTACCCATTCAGGCTGCACCAAGTGTACTTTGATGCACCCTCCTGCGTTAAAGGGGGCACTACCAAGATCTTCCTAGTTGGTGACTACTCCTCCTCGGGTGAATTCTTTGTCACCGTGGCTGTGTTTGCCTTCCTCTACTCCATGGGGGCCCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAACAACAAAGGGCCAATGATGGACTTCCTGGCCACAGCAGTGTTCGCTTTCATGTGGCTAGTTAGCTCATCCGCCTGGGCCAAAGGCCTGTCCGATGTGAAGATGGCCACTGACCCAGAGAACATTATCAAGGAGATGCCTATGTGCCGCCAGACAGGAAACACATGCAAGGAACTGAGGGACCCTGT

Ensembl | 마우스 수납 번호

ENSMUSG00000031144

NCBI 수납 번호

NM_009305

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... SYP(20977) , Syp(20977)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hsueh-Chun Wang et al.
BMC cancer, 14, 442-442 (2014-06-17)
Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet
Toru Mitsumori et al.
Experimental hematology, 42(9), 783-792 (2014-05-28)
The hypoxic microenvironment of the bone marrow, known as the hypoxic niche, supports hematopoietic stem cell quiescence and maintains long-term repopulation activity. Hypoxia also affects the expansion of progenitor cells and enhances erythropoiesis and megakaryopoiesis. In contrast to the known
Rong-Ping Zhou et al.
Molecular medicine reports, 11(6), 4489-4495 (2015-01-31)
Chlorogenic acid (CGA) exhibits various biological properties, including the inhibition of oxidation, obesity, apoptosis and tumorigenesis. CGA is also able to promote cell survival and proliferation. The aim of the present study was to determine the effects and underlying molecular
K S Siveen et al.
British journal of cancer, 111(7), 1327-1337 (2014-08-08)
Constitutive activation of signal transducer and activator of transcription signalling 3 (STAT3) has been linked with survival, proliferation and angiogenesis in a wide variety of malignancies including hepatocellular carcinoma (HCC). We evaluated the effect of lupeol on STAT3 signalling cascade

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.