콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU032471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chek2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAACAAGCGCCTGAAAGAAGCCACCTGTAAGCTCTACTTCTACCAGATGCTTGTAGCTGTACAGTACCTTCACGAAAATGGGATCATACATCGGGACTTAAAGCCGGAGAATGTTCTTTTATCATCTCAGGAAGAGGATTGTCTAATCAAGATCACTGACTTTGGGCAGTCCAAGATCTTGGGGGAGACCTCCTTGATGAGAACCTTATGTGGTACGCCCACTTATCTGGCTCCTGAGGTTCTTGTCTCCAACGGGACTGCTGGGTACAGCCGCGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTCATCTGCCTAAGTGGGTATCCACCTTTCTCTGAGCATAAGACCCAAGTGTCCCTGAAGGATCAGATCACCAGTGGAAAGTACAACTTTATTCCTGAAGTCTGGACAGATGTCTCAGAGGAGGCTCTGGACCTTGTCAAGAAACTGTTAGTTGTAGACCCAAAGGCTCG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Hui Ling et al.
Oncology reports, 32(5), 2274-2282 (2014-09-02)
Previous studies have shown that diallyl disulfide (DADS), a naturally occurring anticancer agent in garlic, arrested human gastric cancer cells (MGC803) in the G2/M phase of the cell cycle. Due to the importance of cell cycle redistribution in DADS-mediated anticarcinogenic
Chao-Ying Huang et al.
PloS one, 9(8), e104732-e104732 (2014-08-12)
In daily life, humans are exposed to the extremely low-frequency electromagnetic fields (ELF-EMFs) generated by electric appliances, and public concern is increasing regarding the biological effects of such exposure. Numerous studies have yielded inconsistent results regarding the biological effects of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.