설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGAAGCGGATGACAAGACTGTGTGGGAGGACACGGACCTGGGGCTGTACAAGGTCAATGAGTATGTGGACGTGCGTGACAATATCTTCGGTGCATGGTTTGAGGCCCAGGTGGTCCAGGTACAGAAGAGAGCCCTATCTGAGGACGAGCCCTGTAGCTCCAGTGCCGTTAAGACCTCGGAGGATGACATCATGTACCATGTCAAGTATGATGACTATCCAGAGCATGGAGTGGACATTGTCAAAGCCAAGAATGTCCGTGCTCGTGCTCGCACTGTGATACCATGGGAGAACCTGGAGGTGGGTCAGGTGGTCATGGCCAACTATAACGTGGACTACCCCAGGAAACGCGGCTTCTGGTATGATGTTGAGATCTGTAGGAAGCGCCAAACCAGGACGGCACGTGAGCTATACGGCAACATCAGGCTCTTGAATGACTCTCAGCTCAACAACTGTCGGATCATGTTTGTGG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... UHRF1(18140) , Uhrf1(18140)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
12 - Non Combustible Liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Feng Yan et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(11), 8887-8893 (2015-06-14)
Ubiquitin-like with PHD and ring finger domains 1 (UHRF1), known as ICB90 or Np95, has been found to be overexpressed in numerous cancers. In this study, we evaluated the expression level of UHRF1 in ovarian cancer. UHRF1 levels in paired
Yiyu Qin et al.
Oncology reports, 31(6), 2635-2643 (2014-04-24)
Ubiquitin-like containing PHD and RING finger domains 1 (UHRF1), overexpressed in various human malignancies, functions as an important regulator in cell proliferation and epigenetic regulation. Depletion of UHRF1 has shown potential antitumor activities in several types of cancer. However, the role
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.