콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU030031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ddit3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAATAACAGCCGGAACCTGAGGAGAGAGTGTTCCAGAAGGAAGTGCATCTTCATACACCACCACACCTGAAAGCAGAACCTGGTCCACGTGCAGTCATGGCAGCTGAGTCCCTGCCTTTCACCTTGGAGACGGTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGATCTGCAGGAGGTCCTGTCCTCAGATGAAAATGGGGGCACCTATATCTCATCCCCAGGAAACGAAGAGGAAGAATCAAAAACCTTCACTACTCTTGACCCTGCGTCCCTAGCTTGGCTGACAGAGGAGCCAGGGCCAACAGAGGTCACACGCACATCCCAAAGCCCTCGCTCTCCAGATTCCAGTCAGAGTTCTATGGCCCAGGAGGAAGAGGAGGAAGAGCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGTGCCCAGCCCGGCCTGGGAAGCAACGCATGAAGGAGAAGGAGCAG

Ensembl | 마우스 수납 번호

ENSMUSG00000025408

NCBI 수납 번호

NM_007837

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... DDIT3(13198) , Ddit3(13198)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

WGK

WGK 1

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

E Aflaki et al.
Cell death & disease, 3, e280-e280 (2012-03-16)
Triacylglycerol (TG) accumulation caused by adipose triglyceride lipase (ATGL) deficiency or very low-density lipoprotein (VLDL) loading of wild-type (Wt) macrophages results in mitochondrial-mediated apoptosis. This phenotype is correlated to depletion of Ca(2+) from the endoplasmic reticulum (ER), an event known
Xin-Yu Zhang et al.
The international journal of biochemistry & cell biology, 68, 158-165 (2015-09-28)
Arsenic trioxide has been proven to trigger apoptosis in human hepatocellular carcinoma cells. Endoplasmic reticulum stress has been known to be involved in apoptosis through the induction of CCAAT/enhancer-binding protein homologous protein. However, it is unknown whether endoplasmic reticulum stress
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Bo Lin Chen et al.
Antioxidants & redox signaling, 23(15), 1233-1245 (2014-09-03)
Renal ischemia-reperfusion (I/R) is a major cause of acute renal failure. The mechanisms of I/R injury include endoplasmic reticulum (ER) stress, inflammatory responses, hypoxia, and generation of reactive oxygen species (ROS). CCAAT/enhancer-binding protein (C/EBP) homologous protein (CHOP) is involved in
Xiuhua Zhang et al.
BMC cancer, 15, 866-866 (2015-11-08)
Prostate cancer is the most commonly diagnosed malignancy among men. The Discovery of new agents for the treatment of prostate cancer is urgently needed. Compound WZ35, a novel analog of the natural product curcumin, exhibited good anti-prostate cancer activity, with
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.