설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAATAACAGCCGGAACCTGAGGAGAGAGTGTTCCAGAAGGAAGTGCATCTTCATACACCACCACACCTGAAAGCAGAACCTGGTCCACGTGCAGTCATGGCAGCTGAGTCCCTGCCTTTCACCTTGGAGACGGTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGATCTGCAGGAGGTCCTGTCCTCAGATGAAAATGGGGGCACCTATATCTCATCCCCAGGAAACGAAGAGGAAGAATCAAAAACCTTCACTACTCTTGACCCTGCGTCCCTAGCTTGGCTGACAGAGGAGCCAGGGCCAACAGAGGTCACACGCACATCCCAAAGCCCTCGCTCTCCAGATTCCAGTCAGAGTTCTATGGCCCAGGAGGAAGAGGAGGAAGAGCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGTGCCCAGCCCGGCCTGGGAAGCAACGCATGAAGGAGAAGGAGCAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... DDIT3(13198) , Ddit3(13198)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
WGK
WGK 1
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
E Aflaki et al.
Cell death & disease, 3, e280-e280 (2012-03-16)
Triacylglycerol (TG) accumulation caused by adipose triglyceride lipase (ATGL) deficiency or very low-density lipoprotein (VLDL) loading of wild-type (Wt) macrophages results in mitochondrial-mediated apoptosis. This phenotype is correlated to depletion of Ca(2+) from the endoplasmic reticulum (ER), an event known
Xin-Yu Zhang et al.
The international journal of biochemistry & cell biology, 68, 158-165 (2015-09-28)
Arsenic trioxide has been proven to trigger apoptosis in human hepatocellular carcinoma cells. Endoplasmic reticulum stress has been known to be involved in apoptosis through the induction of CCAAT/enhancer-binding protein homologous protein. However, it is unknown whether endoplasmic reticulum stress
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Bo Lin Chen et al.
Antioxidants & redox signaling, 23(15), 1233-1245 (2014-09-03)
Renal ischemia-reperfusion (I/R) is a major cause of acute renal failure. The mechanisms of I/R injury include endoplasmic reticulum (ER) stress, inflammatory responses, hypoxia, and generation of reactive oxygen species (ROS). CCAAT/enhancer-binding protein (C/EBP) homologous protein (CHOP) is involved in
Xiuhua Zhang et al.
BMC cancer, 15, 866-866 (2015-11-08)
Prostate cancer is the most commonly diagnosed malignancy among men. The Discovery of new agents for the treatment of prostate cancer is urgently needed. Compound WZ35, a novel analog of the natural product curcumin, exhibited good anti-prostate cancer activity, with
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.